ID: 1005140473

View in Genome Browser
Species Human (GRCh38)
Location 6:22626195-22626217
Sequence CCTAGGGCCTGGCACAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005140473_1005140485 16 Left 1005140473 6:22626195-22626217 CCTTTCCTGTGCCAGGCCCTAGG No data
Right 1005140485 6:22626234-22626256 CGCTGCCTATGGACTGCAGACGG No data
1005140473_1005140487 22 Left 1005140473 6:22626195-22626217 CCTTTCCTGTGCCAGGCCCTAGG No data
Right 1005140487 6:22626240-22626262 CTATGGACTGCAGACGGCCCAGG No data
1005140473_1005140481 5 Left 1005140473 6:22626195-22626217 CCTTTCCTGTGCCAGGCCCTAGG No data
Right 1005140481 6:22626223-22626245 CTTGTCCAACCCGCTGCCTATGG No data
1005140473_1005140488 26 Left 1005140473 6:22626195-22626217 CCTTTCCTGTGCCAGGCCCTAGG No data
Right 1005140488 6:22626244-22626266 GGACTGCAGACGGCCCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005140473 Original CRISPR CCTAGGGCCTGGCACAGGAA AGG (reversed) Intergenic
No off target data available for this crispr