ID: 1005140476

View in Genome Browser
Species Human (GRCh38)
Location 6:22626206-22626228
Sequence GACAAGGTTGGCCTAGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005140476_1005140489 27 Left 1005140476 6:22626206-22626228 CCAGGCCCTAGGCCAACCTTGTC No data
Right 1005140489 6:22626256-22626278 GCCCAGGATGGCTTTGAATGTGG 0: 225
1: 340
2: 474
3: 362
4: 371
1005140476_1005140487 11 Left 1005140476 6:22626206-22626228 CCAGGCCCTAGGCCAACCTTGTC No data
Right 1005140487 6:22626240-22626262 CTATGGACTGCAGACGGCCCAGG No data
1005140476_1005140488 15 Left 1005140476 6:22626206-22626228 CCAGGCCCTAGGCCAACCTTGTC No data
Right 1005140488 6:22626244-22626266 GGACTGCAGACGGCCCAGGATGG No data
1005140476_1005140481 -6 Left 1005140476 6:22626206-22626228 CCAGGCCCTAGGCCAACCTTGTC No data
Right 1005140481 6:22626223-22626245 CTTGTCCAACCCGCTGCCTATGG No data
1005140476_1005140485 5 Left 1005140476 6:22626206-22626228 CCAGGCCCTAGGCCAACCTTGTC No data
Right 1005140485 6:22626234-22626256 CGCTGCCTATGGACTGCAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005140476 Original CRISPR GACAAGGTTGGCCTAGGGCC TGG (reversed) Intergenic
No off target data available for this crispr