ID: 1005140478

View in Genome Browser
Species Human (GRCh38)
Location 6:22626212-22626234
Sequence GGGTTGGACAAGGTTGGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005140478_1005140487 5 Left 1005140478 6:22626212-22626234 CCTAGGCCAACCTTGTCCAACCC No data
Right 1005140487 6:22626240-22626262 CTATGGACTGCAGACGGCCCAGG No data
1005140478_1005140485 -1 Left 1005140478 6:22626212-22626234 CCTAGGCCAACCTTGTCCAACCC No data
Right 1005140485 6:22626234-22626256 CGCTGCCTATGGACTGCAGACGG No data
1005140478_1005140488 9 Left 1005140478 6:22626212-22626234 CCTAGGCCAACCTTGTCCAACCC No data
Right 1005140488 6:22626244-22626266 GGACTGCAGACGGCCCAGGATGG No data
1005140478_1005140489 21 Left 1005140478 6:22626212-22626234 CCTAGGCCAACCTTGTCCAACCC No data
Right 1005140489 6:22626256-22626278 GCCCAGGATGGCTTTGAATGTGG 0: 225
1: 340
2: 474
3: 362
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005140478 Original CRISPR GGGTTGGACAAGGTTGGCCT AGG (reversed) Intergenic
No off target data available for this crispr