ID: 1005140481

View in Genome Browser
Species Human (GRCh38)
Location 6:22626223-22626245
Sequence CTTGTCCAACCCGCTGCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005140466_1005140481 15 Left 1005140466 6:22626185-22626207 CCCCCACCCTCCTTTCCTGTGCC No data
Right 1005140481 6:22626223-22626245 CTTGTCCAACCCGCTGCCTATGG No data
1005140465_1005140481 19 Left 1005140465 6:22626181-22626203 CCAGCCCCCACCCTCCTTTCCTG No data
Right 1005140481 6:22626223-22626245 CTTGTCCAACCCGCTGCCTATGG No data
1005140468_1005140481 13 Left 1005140468 6:22626187-22626209 CCCACCCTCCTTTCCTGTGCCAG No data
Right 1005140481 6:22626223-22626245 CTTGTCCAACCCGCTGCCTATGG No data
1005140476_1005140481 -6 Left 1005140476 6:22626206-22626228 CCAGGCCCTAGGCCAACCTTGTC No data
Right 1005140481 6:22626223-22626245 CTTGTCCAACCCGCTGCCTATGG No data
1005140472_1005140481 8 Left 1005140472 6:22626192-22626214 CCTCCTTTCCTGTGCCAGGCCCT No data
Right 1005140481 6:22626223-22626245 CTTGTCCAACCCGCTGCCTATGG No data
1005140467_1005140481 14 Left 1005140467 6:22626186-22626208 CCCCACCCTCCTTTCCTGTGCCA No data
Right 1005140481 6:22626223-22626245 CTTGTCCAACCCGCTGCCTATGG No data
1005140473_1005140481 5 Left 1005140473 6:22626195-22626217 CCTTTCCTGTGCCAGGCCCTAGG No data
Right 1005140481 6:22626223-22626245 CTTGTCCAACCCGCTGCCTATGG No data
1005140469_1005140481 12 Left 1005140469 6:22626188-22626210 CCACCCTCCTTTCCTGTGCCAGG No data
Right 1005140481 6:22626223-22626245 CTTGTCCAACCCGCTGCCTATGG No data
1005140475_1005140481 0 Left 1005140475 6:22626200-22626222 CCTGTGCCAGGCCCTAGGCCAAC No data
Right 1005140481 6:22626223-22626245 CTTGTCCAACCCGCTGCCTATGG No data
1005140471_1005140481 9 Left 1005140471 6:22626191-22626213 CCCTCCTTTCCTGTGCCAGGCCC No data
Right 1005140481 6:22626223-22626245 CTTGTCCAACCCGCTGCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005140481 Original CRISPR CTTGTCCAACCCGCTGCCTA TGG Intergenic
No off target data available for this crispr