ID: 1005140487

View in Genome Browser
Species Human (GRCh38)
Location 6:22626240-22626262
Sequence CTATGGACTGCAGACGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005140469_1005140487 29 Left 1005140469 6:22626188-22626210 CCACCCTCCTTTCCTGTGCCAGG No data
Right 1005140487 6:22626240-22626262 CTATGGACTGCAGACGGCCCAGG No data
1005140477_1005140487 6 Left 1005140477 6:22626211-22626233 CCCTAGGCCAACCTTGTCCAACC No data
Right 1005140487 6:22626240-22626262 CTATGGACTGCAGACGGCCCAGG No data
1005140468_1005140487 30 Left 1005140468 6:22626187-22626209 CCCACCCTCCTTTCCTGTGCCAG No data
Right 1005140487 6:22626240-22626262 CTATGGACTGCAGACGGCCCAGG No data
1005140471_1005140487 26 Left 1005140471 6:22626191-22626213 CCCTCCTTTCCTGTGCCAGGCCC No data
Right 1005140487 6:22626240-22626262 CTATGGACTGCAGACGGCCCAGG No data
1005140473_1005140487 22 Left 1005140473 6:22626195-22626217 CCTTTCCTGTGCCAGGCCCTAGG No data
Right 1005140487 6:22626240-22626262 CTATGGACTGCAGACGGCCCAGG No data
1005140475_1005140487 17 Left 1005140475 6:22626200-22626222 CCTGTGCCAGGCCCTAGGCCAAC No data
Right 1005140487 6:22626240-22626262 CTATGGACTGCAGACGGCCCAGG No data
1005140476_1005140487 11 Left 1005140476 6:22626206-22626228 CCAGGCCCTAGGCCAACCTTGTC No data
Right 1005140487 6:22626240-22626262 CTATGGACTGCAGACGGCCCAGG No data
1005140472_1005140487 25 Left 1005140472 6:22626192-22626214 CCTCCTTTCCTGTGCCAGGCCCT No data
Right 1005140487 6:22626240-22626262 CTATGGACTGCAGACGGCCCAGG No data
1005140479_1005140487 -1 Left 1005140479 6:22626218-22626240 CCAACCTTGTCCAACCCGCTGCC No data
Right 1005140487 6:22626240-22626262 CTATGGACTGCAGACGGCCCAGG No data
1005140480_1005140487 -5 Left 1005140480 6:22626222-22626244 CCTTGTCCAACCCGCTGCCTATG No data
Right 1005140487 6:22626240-22626262 CTATGGACTGCAGACGGCCCAGG No data
1005140478_1005140487 5 Left 1005140478 6:22626212-22626234 CCTAGGCCAACCTTGTCCAACCC No data
Right 1005140487 6:22626240-22626262 CTATGGACTGCAGACGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005140487 Original CRISPR CTATGGACTGCAGACGGCCC AGG Intergenic
No off target data available for this crispr