ID: 1005140489

View in Genome Browser
Species Human (GRCh38)
Location 6:22626256-22626278
Sequence GCCCAGGATGGCTTTGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1772
Summary {0: 225, 1: 340, 2: 474, 3: 362, 4: 371}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005140478_1005140489 21 Left 1005140478 6:22626212-22626234 CCTAGGCCAACCTTGTCCAACCC No data
Right 1005140489 6:22626256-22626278 GCCCAGGATGGCTTTGAATGTGG 0: 225
1: 340
2: 474
3: 362
4: 371
1005140477_1005140489 22 Left 1005140477 6:22626211-22626233 CCCTAGGCCAACCTTGTCCAACC No data
Right 1005140489 6:22626256-22626278 GCCCAGGATGGCTTTGAATGTGG 0: 225
1: 340
2: 474
3: 362
4: 371
1005140480_1005140489 11 Left 1005140480 6:22626222-22626244 CCTTGTCCAACCCGCTGCCTATG No data
Right 1005140489 6:22626256-22626278 GCCCAGGATGGCTTTGAATGTGG 0: 225
1: 340
2: 474
3: 362
4: 371
1005140476_1005140489 27 Left 1005140476 6:22626206-22626228 CCAGGCCCTAGGCCAACCTTGTC No data
Right 1005140489 6:22626256-22626278 GCCCAGGATGGCTTTGAATGTGG 0: 225
1: 340
2: 474
3: 362
4: 371
1005140483_1005140489 1 Left 1005140483 6:22626232-22626254 CCCGCTGCCTATGGACTGCAGAC No data
Right 1005140489 6:22626256-22626278 GCCCAGGATGGCTTTGAATGTGG 0: 225
1: 340
2: 474
3: 362
4: 371
1005140486_1005140489 -6 Left 1005140486 6:22626239-22626261 CCTATGGACTGCAGACGGCCCAG No data
Right 1005140489 6:22626256-22626278 GCCCAGGATGGCTTTGAATGTGG 0: 225
1: 340
2: 474
3: 362
4: 371
1005140482_1005140489 5 Left 1005140482 6:22626228-22626250 CCAACCCGCTGCCTATGGACTGC No data
Right 1005140489 6:22626256-22626278 GCCCAGGATGGCTTTGAATGTGG 0: 225
1: 340
2: 474
3: 362
4: 371
1005140479_1005140489 15 Left 1005140479 6:22626218-22626240 CCAACCTTGTCCAACCCGCTGCC No data
Right 1005140489 6:22626256-22626278 GCCCAGGATGGCTTTGAATGTGG 0: 225
1: 340
2: 474
3: 362
4: 371
1005140484_1005140489 0 Left 1005140484 6:22626233-22626255 CCGCTGCCTATGGACTGCAGACG No data
Right 1005140489 6:22626256-22626278 GCCCAGGATGGCTTTGAATGTGG 0: 225
1: 340
2: 474
3: 362
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005140489 Original CRISPR GCCCAGGATGGCTTTGAATG TGG Intergenic
900690869 1:3979594-3979616 GCCCAGGAAGGCTGTGCCTGTGG + Intergenic
900994738 1:6114598-6114620 GCCCAGGATGGCTTTGAATGTGG - Intronic
901101008 1:6718822-6718844 GCCCAGGACGATTTTGAATGTGG + Intergenic
901214388 1:7547628-7547650 GCCCAGGACAGCTTTGAATGTGG + Intronic
901241747 1:7698343-7698365 AGCCAGGACAGCTTTGAATGTGG - Intronic
901257295 1:7841189-7841211 GCCCAGGATGGCTTTGAATGTGG - Intronic
901371238 1:8799677-8799699 GCCCAGGACAGGTTTGAATGAGG + Intronic
901574633 1:10190997-10191019 GCCCAGGACAGCTCTGAATGTGG + Intergenic
901864623 1:12096500-12096522 GCCCAGGACAGCTCTGAATGAGG - Intronic
902035334 1:13453876-13453898 GCTCAGGATGGCTTTGAATGTGG + Intergenic
902131716 1:14267426-14267448 GCCTGGGATTGCTTTGAATGTGG - Intergenic
902163091 1:14548114-14548136 GCCCAGGGTGGCTTTGAATGCGG - Intergenic
902271694 1:15309598-15309620 GCCCAGGACAGCTTTGAATGAGG + Intronic
902938813 1:19784923-19784945 GCCCAGGACAGCTTTGAATGCGG - Intronic
903042188 1:20539627-20539649 GCCCAGGATGGCTACGAATGTGG - Intergenic
903137689 1:21320089-21320111 ACCTGGGATGGCTTTGAATGCGG - Intronic
903402813 1:23069561-23069583 GCCCAGGACAGTTTTGAATGCGG - Intronic
903715105 1:25359574-25359596 GCCCAGGACAGCTTTGAATGAGG - Intronic
903983704 1:27209094-27209116 GCCCACAATGGCTTTGAATGCGG + Intergenic
904001005 1:27338742-27338764 GCACAGGGTGGCTCTGAGTGGGG - Intergenic
904049405 1:27629988-27630010 GCCCAGGACAGCTTTGAATGTGG + Intronic
904206314 1:28857691-28857713 GCCCAGGGTGGTTTTGAACTAGG + Intronic
904511846 1:31017438-31017460 GCCCAGAACTGCTTTGAATGTGG + Intronic
904984219 1:34531565-34531587 GCCCAGGACAGCTTTGAATGTGG - Intergenic
905141383 1:35847559-35847581 GCCCAGGATGGCTTTGAATGTGG - Intronic
905373985 1:37505417-37505439 GCCCAGGACGGCTTTGAATATGG + Intronic
905672075 1:39798397-39798419 GCCCAGGACAGCTTTGAATGCGG - Intergenic
905746945 1:40426223-40426245 GCCCAGGATGGCTTTGAATGAGG - Intergenic
906075354 1:43048072-43048094 GCCCAGGATGGCTTTGAATGTGG + Intergenic
906390972 1:45415875-45415897 GCCCAGAATGGCTTTCAATGTGG + Intronic
906450970 1:45947380-45947402 GTCCAGGACAGCTTTGAATGTGG - Intronic
906543003 1:46602578-46602600 GCCCTGGATGGCTCTGAATGTGG + Intronic
906581666 1:46940340-46940362 GCTCAGGATGGCTTTGAATGTGG - Intronic
906602050 1:47138558-47138580 GCTCAGGATGGCTTTGAATGTGG + Intronic
906820530 1:48925444-48925466 GCCCAGAATGGCTTTGAATGTGG + Intronic
906823387 1:48952790-48952812 GTCCAAGATAGCTTTGAATGGGG + Intronic
907064956 1:51471933-51471955 GCCCAGGACAGCTTTGCACGTGG + Intronic
907140382 1:52180930-52180952 GCCCAGGCTGGCATGCAATGGGG - Intronic
907196207 1:52689083-52689105 GCCTGGGATGGCTTTGAAAGCGG + Intronic
907221405 1:52909596-52909618 GCCCAGGATGGCTTTGAATGTGG - Intronic
907257999 1:53194835-53194857 GCTCAGGATGGCTTTGAATGAGG + Intergenic
907541251 1:55216613-55216635 GCCCAGGACGGCTTTGAATGCGG - Intergenic
907582523 1:55584857-55584879 GGCCATGGTGGCTTTGAATGGGG - Intergenic
907755760 1:57308985-57309007 GCCCAGGGTGGCTTTGAATGCGG + Intronic
907895845 1:58690607-58690629 GCCCAGGACGGCTTCAAATGTGG + Intronic
908018936 1:59879686-59879708 GCCCAGGATGGCTTTGAATGCGG - Intergenic
908091808 1:60694053-60694075 GCCAAGGATGGTTTTGAATGTGG + Intergenic
908146955 1:61256499-61256521 GCCCAGGACAGCTTTGAACACGG - Intronic
908249765 1:62256011-62256033 GCCCAGGACAGCTTTGAATGTGG + Intronic
908259221 1:62326743-62326765 GCCCAGGTTGGTTTTGAACTGGG + Intergenic
908794979 1:67822129-67822151 GCCCAGGACGACTTTGAATGCGG - Intronic
908828761 1:68158655-68158677 GCCCAGGACGGCTTTGAATGTGG - Intronic
909034728 1:70583828-70583850 GCCCAGAATGGCTTTGAATGTGG + Intergenic
909330675 1:74406249-74406271 GCTCAGAATGGCTTTGAATGTGG + Intronic
909389162 1:75098536-75098558 GCCCAGGACGACTTTGAATGCGG + Intergenic
909475974 1:76081363-76081385 GCGCAGGACAGCTTTGAATGTGG - Intronic
909613318 1:77576833-77576855 GCCCACGACAGCTTTGAATGTGG - Intronic
909905663 1:81191500-81191522 GCCCAGTGCGGCTTTGAATGTGG - Intergenic
910160394 1:84266309-84266331 GCCCAGGACAGCTTTGAATGTGG - Intergenic
910164480 1:84310413-84310435 GCCCAGGATGGCTTTGACTGTGG - Intronic
910203610 1:84725234-84725256 GCCCAGGATGGCTTTGAATGTGG + Intergenic
910275827 1:85448070-85448092 GCCTAGGACGGCTTTGAATGCGG + Intronic
910730589 1:90391789-90391811 GCCTGGGACAGCTTTGAATGTGG - Intergenic
910823537 1:91379540-91379562 GCCCAGGATGGCTTTGAATGCGG - Intronic
910863383 1:91764978-91765000 GCCCAGGATGGCTTTGAATGAGG + Intronic
910906939 1:92191270-92191292 GCCCAGGCTGGTCTTGAATTGGG + Intergenic
911005251 1:93214133-93214155 GCCCAGGATGGTCTTGAATTGGG + Intronic
911191079 1:94949034-94949056 GCCTAGGATGGCTTTGAATGTGG + Intergenic
911279530 1:95905470-95905492 GCCCAGGATGGCTTTGAAAGTGG - Intergenic
911331894 1:96533989-96534011 GCCCAGGATGGTTTTGAATGTGG - Intergenic
911617471 1:100030412-100030434 GCCCAGGATGGCTTTGAATGTGG + Intergenic
911680864 1:100713648-100713670 GCCCAGAACAGCTTGGAATGTGG - Intergenic
911828968 1:102525966-102525988 GCCCAGGATGGCTTTAAATGCGG - Intergenic
911925465 1:103825180-103825202 GCTCAGGATTACTTTGACTGGGG - Intergenic
912328196 1:108789254-108789276 GCCCAGGACGGCTGTGAATGTGG + Intronic
912939932 1:114035849-114035871 GCCCAGGATGGCTTTAAATATGG - Intergenic
913015638 1:114731748-114731770 GCCTAGGACAGCTCTGAATGTGG + Intronic
913061064 1:115208631-115208653 GCCCAGGACAGCCTTGAATGCGG - Intergenic
913235152 1:116774552-116774574 GCTCAGGATGGCTTTGAATGTGG + Intergenic
913358958 1:117957623-117957645 GCCCAGTATGGCTTTGAATGTGG + Intronic
913420173 1:118658287-118658309 GCCCAGGATGGCTTTGAATGTGG - Intergenic
914201998 1:145493394-145493416 GCCCAGGCTGGTTTTGAATTAGG - Intergenic
914235926 1:145811308-145811330 GCCCAGGCTGGTTTTGAGTTAGG - Intronic
914886759 1:151591494-151591516 CGTCAGGATGGCTTTGAATGTGG + Intergenic
914972645 1:152324599-152324621 GCCCAGGACAGCTTTGAATGTGG + Intronic
915394351 1:155571240-155571262 ACCCAGGACGGCTTTGAATAGGG + Intergenic
915796310 1:158738119-158738141 GCCCAAGATAGCTTTGAATGTGG - Intergenic
915933202 1:160073143-160073165 GCCCAGGACAGCTTTGAATGAGG - Intergenic
916430626 1:164724533-164724555 GCCCAGACCAGCTTTGAATGTGG - Intronic
916468643 1:165098925-165098947 GCCCAGGACAGCTTTGAACAGGG - Intergenic
916503594 1:165407980-165408002 GCCCAGGGTGGCAGTGAAGGGGG - Intronic
916776143 1:167966319-167966341 GCCCAGGACAGCTTTGAATGTGG + Intronic
917179360 1:172278481-172278503 GCCCAGGATGGCTTTGGATGTGG - Intronic
917543048 1:175934093-175934115 GCCCAGGACGGCTTTGAATGTGG + Intergenic
917811512 1:178662992-178663014 GCCCAGGAGGGCTGTGATTGTGG - Intergenic
917919535 1:179739462-179739484 TCCCAGGATGGTTTTGAATGCGG + Intergenic
918049791 1:180964204-180964226 GCCCAGGACGTCTTCGAATGCGG - Intergenic
918243236 1:182638156-182638178 GCCCAGGCTGGCCTTGAACTGGG - Intergenic
918334666 1:183496887-183496909 GCCCAGGACGGCTTTAACTGCGG - Intronic
918450335 1:184651335-184651357 GCCCAGGATGGCTTTGAATGTGG + Intergenic
918478592 1:184952633-184952655 GCCCGGGAAGGCTTTGAATGTGG - Intronic
918527153 1:185477621-185477643 GCCCAGGACAGCTTTCAATGAGG + Intergenic
918527969 1:185485877-185485899 GCCCAGGATGGCTTTGAATGCGG - Intergenic
918733200 1:188023766-188023788 ACCCTGGATGGCTTTGAATGTGG - Intergenic
918737295 1:188081084-188081106 GCCTAGGATGGCTTTGAATGTGG - Intergenic
919002967 1:191858223-191858245 GCCCAGGACAGCTTTGAATGTGG + Intergenic
919005247 1:191890774-191890796 GCCCAGGACAGCTTTGAATGTGG - Intergenic
919434893 1:197545431-197545453 ACCTAGGATAGCTTTGAATGTGG - Intronic
919447843 1:197731760-197731782 GGCCAGGACAGCTTTGAATGTGG - Intronic
919472874 1:198000514-198000536 ACCTAGGATGGCTTTGAATGAGG + Intergenic
919633864 1:199985296-199985318 GCCCAGGATGGCTTTGAATGCGG - Intergenic
919736337 1:200954308-200954330 GCCCTGGACAGCTTTGAATGTGG - Intergenic
919759937 1:201091582-201091604 GCCTAGGATGGCTCAGAAGGGGG - Intronic
919766447 1:201130296-201130318 GCCCCTGATGGCTCTGAAGGAGG + Intergenic
920013486 1:202887278-202887300 GCTCAGAACGGCTTTGAATGCGG + Intronic
920276629 1:204810903-204810925 GCCCAGGACGGTTTTGAATGTGG + Intergenic
920318204 1:205095309-205095331 GCCTAGGACAGCTTTGAATGTGG + Intronic
920332782 1:205222904-205222926 GCCCAGGACGGCTTTGAATGAGG - Intergenic
920372486 1:205488115-205488137 GCCCAGGATGGCTTTGAATGTGG - Intergenic
920497505 1:206465768-206465790 GCCCAGGATGGCTTTGAATGTGG + Intergenic
920613695 1:207468278-207468300 GCCCAGGATGGCTTTGAATGTGG + Intronic
920717775 1:208357065-208357087 GCCCAGGACAGCTTTGAATGTGG + Intergenic
920926163 1:210343702-210343724 GTCCAGGGTGGCTTTGGATTGGG + Intronic
921210304 1:212890523-212890545 GCCCAGGACAGTTTTGAATGTGG - Intronic
921409292 1:214817722-214817744 GCCCAGGATAGCTTTGAATGCGG + Intergenic
921432154 1:215078178-215078200 GCCCAGGATGGCTTTGAATGTGG - Intronic
921472452 1:215565855-215565877 GCCCAGGAAAGCTTTGAATGTGG + Intergenic
921555114 1:216589297-216589319 GCTGAGGACAGCTTTGAATGTGG + Intronic
921564753 1:216703367-216703389 GCCCAGGACGGCTTTGAATGCGG - Intronic
921596376 1:217057757-217057779 GCCCAGAATGACTTTGAATGTGG + Intronic
921709936 1:218363926-218363948 GTCCAGGATGGCCTTGAATGCGG + Intronic
921935243 1:220789503-220789525 GCCCAGGACAGCTTTGAATGAGG - Intronic
922237090 1:223730277-223730299 GCCCAGGATGGCTTTGAATGTGG + Intronic
922307736 1:224358508-224358530 GTCCAGGACAGCTTTGAATGTGG + Intronic
922435994 1:225607295-225607317 GCCCAGGATGGCTTTGAATGTGG - Intronic
922669582 1:227498851-227498873 GCCAAAGTTGGATTTGAATGGGG + Intergenic
922670011 1:227502451-227502473 GCCAAAGTTGGATTTGAATGGGG - Intergenic
922895635 1:229097810-229097832 GACCAGGAAGGCTTTGAAGCAGG - Intergenic
922944882 1:229504965-229504987 GCCCAGGACAGCTTTGAATGCGG + Intronic
923116762 1:230947615-230947637 GCCCAGGATGGCTTTGAATGTGG - Intronic
923220789 1:231891278-231891300 GCCCAGGATGGCTTTGAATGTGG - Intronic
923472941 1:234308386-234308408 GTCCAGGCTGGCTTTGAATGAGG + Intronic
923570451 1:235108479-235108501 GTCCAGGGCAGCTTTGAATGTGG + Intergenic
923586904 1:235281208-235281230 GCCCAGGCTGGTTTTGAACTGGG - Intronic
923660787 1:235955278-235955300 ACCCAGGATGACTTTGGATGTGG + Intergenic
923764272 1:236878667-236878689 GCTCAGGACAGCTTTGAATGTGG - Intronic
923827651 1:237517555-237517577 GCCCAGGATGGCTTTGAATGTGG - Intronic
923954661 1:239002242-239002264 TCCCAGGATGGTTTTGAATGAGG + Intergenic
923955488 1:239013765-239013787 GCCCCAGATGACTTTGAATGTGG + Intergenic
923978649 1:239295016-239295038 TCCCAGGACAGCTTTGAATATGG - Intergenic
924138687 1:240999433-240999455 GCCCAGGACATCTTTGAATATGG - Intronic
924146035 1:241075658-241075680 GCCCAGAATGACTTTGAATGTGG - Intronic
924359663 1:243224520-243224542 GCCCAGGACGGCTTTGAATGCGG - Intronic
924376245 1:243412448-243412470 GGCCTGGATGGTTTTGAATGCGG - Intronic
924666165 1:246073993-246074015 GCCCAGCATGGCTTTGAATGTGG + Intronic
924714486 1:246560019-246560041 GCCCAGGACGGCTTTGAATGTGG + Intronic
924942201 1:248819781-248819803 GCCCAGGATGGCTTTGAACACGG - Intronic
1062871937 10:912375-912397 GCCTGGGATGGCTTTGAATGCGG - Intronic
1063018307 10:2100730-2100752 GCCCAGGACGACTTTAAATGTGG - Intergenic
1063224124 10:3998707-3998729 GCCCAGGACAGCTTTGAATGTGG - Intergenic
1063415395 10:5869006-5869028 GGCCCAGGTGGCTTTGAATGTGG + Intronic
1063696824 10:8343837-8343859 GACCAGTATGGCTTTCCATGAGG + Intergenic
1063738720 10:8793266-8793288 ACCCTAGATGGCTTTGAATGTGG + Intergenic
1063880359 10:10525298-10525320 GCCCAGAACAGCTTTGAAGGTGG + Intergenic
1064054148 10:12083346-12083368 GCCCAGGACAGCTTTGAATGTGG - Intronic
1064054152 10:12083368-12083390 GCCCAGGACAGCTTTGAATGTGG - Intronic
1064189136 10:13190036-13190058 GCCCAGGATGGCTTTGAATGCGG - Intronic
1064368973 10:14734414-14734436 GTCCAGGGCGGCTTTGAAGGTGG + Intronic
1064512535 10:16111099-16111121 GCCCAGAATGGCTTTAAATGCGG - Intergenic
1064706651 10:18079376-18079398 GCCCAGGATGGTCTTGAATGTGG - Intergenic
1064918243 10:20486452-20486474 GCCCAGGATGGCTTTGAATGCGG + Intergenic
1064959512 10:20948040-20948062 ACCCAGGACAGCTTTGAATGTGG - Intronic
1064983422 10:21186587-21186609 GCCCAAGATGGCTTAGAATGTGG + Intergenic
1065053914 10:21823803-21823825 GCCCAGGACAGCTTTGAACGTGG - Intronic
1065124063 10:22555965-22555987 GCCCAGGACGGCTTTGAATGTGG - Intronic
1065248377 10:23783252-23783274 GGCCAGGATAGCTTTAAATGTGG - Intronic
1065616762 10:27535191-27535213 GCCCAGGATGGCTTTGAATGTGG + Intronic
1065685204 10:28277464-28277486 GCCCAGGACGGCTTTGAATGTGG - Intronic
1065700173 10:28417325-28417347 GCCCAGGACAGCCTTGAATGTGG - Intergenic
1065718709 10:28603284-28603306 GCCTAGGACAGCTTTGAATGTGG - Intronic
1065796416 10:29312315-29312337 GCCCAGGATGGCTTTGAATGTGG + Intronic
1066176096 10:32907896-32907918 GCCCAGAATAGCTTTGAATGTGG - Intronic
1066264459 10:33762164-33762186 ACCCAGAATGGCTTTGAATATGG + Intergenic
1066296509 10:34058575-34058597 GCCCGGGATGGCTTTGTCTGCGG + Intergenic
1066302283 10:34107715-34107737 GCCTGGGATGGCTTTGAATGTGG - Intergenic
1066326891 10:34369225-34369247 GTCCAGGATGGCTTTGAATGTGG + Intronic
1066359545 10:34716890-34716912 CCTCAGGATGGCTTTGAATGTGG + Intronic
1066975583 10:42365415-42365437 GCCCAGAATGTCTTTGAGTTGGG - Intergenic
1067138421 10:43632741-43632763 GGCCCAGATAGCTTTGAATGCGG + Intergenic
1067342794 10:45418595-45418617 GCCCAGGAAGGCTTTGCAGCCGG + Intronic
1067380380 10:45767812-45767834 GCCCAGTATGGCTTTGAATGCGG - Intronic
1067783778 10:49227939-49227961 GCCCAGGCTGGCTGTGCAGGTGG - Intergenic
1067881130 10:50046158-50046180 GCCCAGTATGGCTTTGAATGCGG + Intergenic
1067888083 10:50108467-50108489 GCCCAGTATGGCTTTGAATGCGG - Intronic
1068025031 10:51632031-51632053 GCCCAGGACAGCTGTGAATGTGG + Intronic
1068036778 10:51769925-51769947 GCCCAGGATGACTTTAAATGTGG - Intronic
1068174101 10:53435149-53435171 GCCAAGTATGGTTTTGAATGCGG + Intergenic
1068243814 10:54339114-54339136 GCCCAGGTTGGCTCTGAATGTGG + Intronic
1068247037 10:54386332-54386354 GCCTAGGACAACTTTGAATGTGG - Intronic
1068458083 10:57286141-57286163 GCCCAGGATGGCTTTGAATGCGG - Intergenic
1068499210 10:57821676-57821698 TCGCAGGATGGCTTTGAATGCGG - Intergenic
1068525125 10:58119977-58119999 ACCCAGGACGGCTTCGAATGGGG + Intergenic
1068816406 10:61319905-61319927 GCCCAGGATGGCTTTGAATGTGG + Intergenic
1068988334 10:63127238-63127260 ACCCAGGACGGCTTTGAATGTGG + Intergenic
1069204162 10:65660985-65661007 GCCCAGGATAGCTTTGAATGTGG + Intergenic
1069261584 10:66404702-66404724 GCCCAGGACAGCTTTGAATGTGG + Intronic
1069575789 10:69527638-69527660 GCCCAGGATGGCTTTAAATGTGG - Intergenic
1069728715 10:70597912-70597934 GCCCAGGATGGCTTTGAATGCGG - Exonic
1069946910 10:71993013-71993035 GCTCAGGACGGCTTTGAATGTGG + Intronic
1070143143 10:73753897-73753919 CCCCAGGACGGCTTTGAATGTGG + Intronic
1070787989 10:79173219-79173241 GCTCAGGACGACTTTGAATGTGG + Intronic
1071389148 10:85153003-85153025 GTCCAGGATGGCTTTGAATGTGG - Intergenic
1071555020 10:86594827-86594849 GCCCAGGACATCTTTGAATGCGG + Intergenic
1071837815 10:89436973-89436995 GCCTGGGATGGCTTTGAATGTGG - Intronic
1071858333 10:89647809-89647831 GCTCAGGACGGCTTTGAATACGG + Intergenic
1072022893 10:91421560-91421582 GCCCAGGATGGCTTTGAATGCGG - Intronic
1072095655 10:92176887-92176909 GCCCAAGACGGCTTTGAATGTGG + Intronic
1072262920 10:93698846-93698868 GCCCAGGATGGCTTTGAATGTGG + Intronic
1072443499 10:95477944-95477966 GCCCAGGACAGCTTTGAATGTGG - Intronic
1072490768 10:95904108-95904130 GCCCAGGACTGCTTTGAATGTGG + Intronic
1072536169 10:96365171-96365193 GCCCAGGACGGCTTTGAATATGG - Exonic
1072608179 10:97000698-97000720 GCCCAGGCTGGCTTGGAACTGGG - Exonic
1072786840 10:98289435-98289457 GCCCAGGACAGCTTTGAATGTGG + Intergenic
1072793235 10:98334516-98334538 GCCCAGGATGGCTTTGGATGCGG + Intergenic
1073074161 10:100813088-100813110 GCTCAGGACAGCTTTGAATGTGG - Intronic
1073303089 10:102482843-102482865 GCCCAGGATGGCTTTCAGTAAGG - Intronic
1073407870 10:103313669-103313691 GCCCAGGATAGCTGCGAATGGGG - Intronic
1074014209 10:109516986-109517008 GGCTAGGACGGCTTTGAATTTGG - Intergenic
1074118108 10:110472956-110472978 GCCCAGGACAGCTTTGAACATGG - Intergenic
1074638804 10:115354076-115354098 GCCCAGGACAGCTTTGAATATGG + Intronic
1074737393 10:116450214-116450236 GCCCAGAACAGCTTTGAATGTGG + Intronic
1074833662 10:117268352-117268374 GCACAGCATGGCTTTCACTGAGG + Intronic
1075030918 10:119024249-119024271 GCCCAGGACAGCTTTGAATGCGG - Intergenic
1075405293 10:122191578-122191600 GCCCAGGACAGCTTTGAATGCGG - Intronic
1075420237 10:122295107-122295129 ACTCAGGATGGATTTGTATGGGG + Intronic
1075435645 10:122438934-122438956 GCCCAGGACGGCTTTGAATGCGG - Exonic
1075488563 10:122847366-122847388 GCCCGGGCTGGCTGTGGATGAGG + Intronic
1075524139 10:123168484-123168506 GCCCAGGATGGCTTTGAAGGTGG + Exonic
1075538220 10:123289334-123289356 GCCCAGGAGGGCTTTGAATGTGG + Intergenic
1075755708 10:124809689-124809711 GCCCATGGCAGCTTTGAATGAGG + Intronic
1075778875 10:125004462-125004484 TCCAAGGATGGATTTGAAGGGGG - Intronic
1076063932 10:127433756-127433778 GCCCAGGATGGCTTTGAATGTGG + Intronic
1076075824 10:127533135-127533157 GCCCAGGATGGCTTTGAATGTGG + Intergenic
1076287765 10:129317077-129317099 GCCCAGGATGGCTCTGAATGTGG + Intergenic
1076340106 10:129739708-129739730 GCCCAGGATAGCTTTGAATGTGG + Intronic
1076602117 10:131664038-131664060 GCCCAGGATGGCTTTTAATGTGG - Intergenic
1077069509 11:661955-661977 GCCCAGGATGGCTTTGCATGAGG + Intronic
1077571504 11:3342369-3342391 GCCCAGAACAGCTTTGAATGTGG - Intronic
1077940618 11:6837608-6837630 GCCCAGGCTGGAGTTCAATGGGG + Intergenic
1077943039 11:6863898-6863920 GCCCAAGATGGCTTTGAATGTGG + Intergenic
1077943193 11:6866354-6866376 GACCAGGACGGCTTTGCATGTGG + Intergenic
1078061334 11:8046977-8046999 GCCCAGGATGGCTTTGAGTGTGG - Intronic
1078164216 11:8868918-8868940 GCCCAGGACGGCTCTGAGTGTGG + Intronic
1078190567 11:9090404-9090426 GCCCAGGACAGTTTTGAATGCGG + Intronic
1078290933 11:10008817-10008839 GCCAAGGAATGCTTTGCATGTGG + Intronic
1078770913 11:14350760-14350782 GCTCAGGACACCTTTGAATGTGG - Intronic
1078859179 11:15231463-15231485 GCCCAGGACAGCTTTGAATGTGG - Intronic
1078892346 11:15568539-15568561 GCCCAGGACAGCTTTGAATGCGG - Intergenic
1079192771 11:18294890-18294912 TTCCAGGACGGCTTTGAACGTGG - Intronic
1079411815 11:20194780-20194802 GCCTAGGACTGCTTTGAATGTGG + Intergenic
1080086176 11:28285300-28285322 GCCCAGGACAGCTTTGAATGTGG + Intronic
1080190310 11:29537506-29537528 GCCCAGGATGGCTTTGAATGTGG + Intergenic
1080295908 11:30727208-30727230 GCCCAGGACAGCTTTGAATGTGG - Intergenic
1080395867 11:31889475-31889497 GCCCAAGGAGGCTTTGAATGCGG - Intronic
1080623684 11:34009071-34009093 TCCCAGGATGGCTTTGAATGGGG - Intergenic
1080712757 11:34765239-34765261 ACCTAGGATTGCTTTGACTGGGG + Intergenic
1080754302 11:35180787-35180809 GTCCAGGATGACTTTGAATGTGG - Intronic
1080755510 11:35193307-35193329 ATGCAGGATGGCTTTGAATGTGG - Intronic
1081270782 11:41079710-41079732 GACCAGGATGGCTTCAAATGTGG + Intronic
1081296471 11:41395975-41395997 GCCCAGGACGGCTTTGAATGCGG + Intronic
1081683961 11:45028405-45028427 TCCCAGGACGGTTTTGAATATGG - Intergenic
1081683977 11:45028492-45028514 ACCCAGGAAGGCTTTGAATATGG - Intergenic
1081739258 11:45426791-45426813 GCCCAGGACAACTTTGAATGCGG - Intergenic
1081805901 11:45890448-45890470 CCCCAGGATGGCTCTGAATGTGG - Intronic
1081816899 11:45950592-45950614 GCCCAGGATGGCTTTGAATGCGG - Intronic
1081936472 11:46907473-46907495 GCCCAGGATGGCTTTGAATGTGG + Intronic
1082847246 11:57736405-57736427 GCCCAGGATGGCTTTGAATGGGG - Intronic
1082853923 11:57789730-57789752 GCCCAGGACAGCTTTGAATGCGG - Intronic
1083011099 11:59400376-59400398 GCCCAGGATGGCTTTGAATGTGG - Intergenic
1083015411 11:59448110-59448132 GCCCAGGACGGCTTTGAATGTGG - Intergenic
1083192957 11:61065813-61065835 TCCCAGGACGGCTTTGAGTGTGG - Intergenic
1083481106 11:62947652-62947674 GCCAAGGAAGGATTTGAAGGAGG + Intronic
1083529809 11:63409504-63409526 GCCCAGGATGGCTTTGAATGTGG - Intronic
1083537882 11:63488601-63488623 GCCCAGGACAGCTTTGAATGTGG + Intronic
1084139781 11:67218477-67218499 GCCCAGGATGGCTTTGAATGTGG + Intronic
1084300458 11:68247354-68247376 GCCCAGGACATCCTTGAATGTGG - Intergenic
1084340050 11:68491930-68491952 GCCCAGGACAGCTCTGAATGAGG - Intronic
1084496578 11:69508224-69508246 GCCCAGTAAGGCTTACAATGAGG + Intergenic
1084540929 11:69786633-69786655 GCCCAGGACGGCTTTGAATGTGG + Intergenic
1084555057 11:69871232-69871254 GCCCAGGACAGCTTTGAATGTGG - Intergenic
1084741843 11:71145369-71145391 GCCCAGGACAGCTTTGAATGCGG - Intronic
1084888896 11:72226914-72226936 GCCAAGGGAGGCTGTGAATGGGG + Intronic
1085113537 11:73909991-73910013 GCCCAGGGTGGCTCTGAATGAGG - Intronic
1085178776 11:74514291-74514313 GCCCAGAATGGCTTTGAATATGG - Intronic
1085781127 11:79410101-79410123 GCCCAGAATGGTTTTGAATGCGG - Intronic
1086229981 11:84556591-84556613 GCCCAGGACAGCTTCGAATGTGG - Intronic
1086480811 11:87236419-87236441 CCCCAAGACAGCTTTGAATGTGG - Intronic
1086576815 11:88347960-88347982 GCACAGGACGGCTTTGAATACGG - Intergenic
1086966433 11:93032809-93032831 GGCCAGGTTGGCTTTGAAGCAGG + Intergenic
1087200973 11:95344348-95344370 GCCCAGGATGACTTTGAATGTGG + Intergenic
1087328116 11:96747797-96747819 GCCCAAGATGACTTTGAATGTGG + Intergenic
1088275804 11:108083913-108083935 GCCCAGGACGGCTTTGAACGTGG + Intronic
1088298548 11:108328827-108328849 GCCCAGGACGGCTTTGAATGTGG - Intronic
1088446221 11:109931608-109931630 GACCAGGATGGCTTTGAATGTGG + Intergenic
1089019360 11:115196672-115196694 GCCCAGGACGGCTTTGAATGCGG - Intronic
1089233522 11:117002224-117002246 TCCCAGGACGGCTTTGAATGTGG + Intronic
1089568190 11:119383742-119383764 GCCCAGGATGGCTTTGAATGTGG - Intergenic
1089928420 11:122283535-122283557 ACCCAGGATGGCTTTGAAAGTGG - Intergenic
1090091753 11:123704163-123704185 GCCCAGAACATCTTTGAATGCGG - Intergenic
1090151631 11:124390522-124390544 GCCAAGGATGGCTTTGAATATGG - Intergenic
1090379513 11:126316254-126316276 GCCCAGGACAGCTTTGAATGCGG + Intronic
1091458955 12:629539-629561 GCCCAGGACGGCTTTGAACGCGG + Intronic
1091600261 12:1913693-1913715 GCCCAGGAAAGCCTGGAATGGGG + Intronic
1091648725 12:2293496-2293518 GTCCAGGATGGCTTTGAATGTGG + Intronic
1091701971 12:2669396-2669418 GCCCAGGACGGCTTTGAATGTGG - Intronic
1091828558 12:3533379-3533401 GCCCAGGATGGCTTTGAATGTGG + Intronic
1091873259 12:3912599-3912621 ACCCAGGACAGCTTTGAATGTGG + Intergenic
1092066020 12:5590151-5590173 GCCCAGGACAGCTTTGAATGTGG + Intronic
1092585742 12:9899432-9899454 GTCCAGGATGCATTTGAAAGGGG + Intronic
1092634761 12:10431715-10431737 ACCCAGGACAGCTTTGAATGCGG + Intronic
1092634889 12:10433057-10433079 CACCAGGATGGCTGTGGATGAGG + Intronic
1092788444 12:12050893-12050915 GCCCAGGATGGCTTTGAATGTGG - Intronic
1092831072 12:12444996-12445018 GTCCAGGACAGCTTTGAGTGTGG - Intronic
1092898548 12:13037227-13037249 GCCCAGGATGGAGTGCAATGGGG + Intergenic
1093158954 12:15722258-15722280 GCCCAGGACAGCTTTGAGTGCGG - Intronic
1093368843 12:18340347-18340369 GCCGAGGATGACATTGAATGTGG - Intronic
1093396460 12:18689373-18689395 GCCCATGGTGGCTTTGAATGCGG + Intronic
1093659772 12:21742216-21742238 GCCCAGGATGGGTTTGGATGTGG + Intronic
1093697108 12:22173009-22173031 GCCAAGGATGGCTTTGAATGTGG - Intronic
1093879452 12:24387291-24387313 GCCCAGGACGGCTTTGAATGTGG + Intergenic
1093972804 12:25390654-25390676 GCCCAGGACGACTTTGAATGTGG - Intergenic
1093999055 12:25674791-25674813 GCCCAAGATGGCTTTGAATGTGG - Intergenic
1094032985 12:26034463-26034485 GGCCCAGATGGCTTTAAATGCGG - Intronic
1094119553 12:26955956-26955978 GCCCAGGATGGCTTTGATTGCGG + Intronic
1094211040 12:27891917-27891939 GGCCCAGATGGCTTGGAATGCGG + Intergenic
1094487213 12:30934574-30934596 GTCCAGGACAGCTTTGAATGCGG + Intronic
1094491893 12:30965947-30965969 GCCCAGGACAGCTTTGAATGCGG + Intronic
1094608023 12:31966220-31966242 GCCCAAGACGGCTTTGAATGAGG - Intronic
1094618535 12:32058355-32058377 GCCCAAGACAGCTTTGAATGTGG - Intergenic
1094773091 12:33689143-33689165 GCACAAGATGGCTTAAAATGTGG + Intergenic
1094800741 12:34031800-34031822 GCCCAGGATGGCTTTGAATGCGG + Intergenic
1095113529 12:38326096-38326118 GCCCAGGATGGCTTTGAATGCGG + Exonic
1095202670 12:39402679-39402701 GCCCAGGATGACTTTGCATGTGG + Intronic
1095279300 12:40331648-40331670 GCCCAGGATGGCTTTGAATGTGG - Intronic
1095372743 12:41488998-41489020 GCCCAGGACAGCTTTGAAAGTGG + Intronic
1095427494 12:42092922-42092944 GCCCAGGATGACTTTGAACATGG - Intronic
1095475442 12:42582736-42582758 ACCCAGGATGGCTTTGAATGTGG + Intronic
1095546208 12:43373566-43373588 GCCCAGGGCAGCTTTGAATGTGG - Intronic
1096131679 12:49164228-49164250 GCCCAGGCTGGATTGCAATGGGG + Intergenic
1096391209 12:51230544-51230566 GCCCAGGATGGCTTTGAATGCGG + Intergenic
1096532655 12:52251447-52251469 GCCCAGGACGGCTTTGAATGTGG - Intronic
1096937053 12:55292292-55292314 GCACAGGACAGCTTTGAATGTGG + Intergenic
1097133756 12:56834731-56834753 AGCCAGGACAGCTTTGAATGTGG - Intergenic
1097264174 12:57736427-57736449 GCCCCGGGTGGGTTTCAATGCGG + Intronic
1097830356 12:64217978-64218000 GTCCAGGATGGCTTTGAATGCGG - Intronic
1097849058 12:64393681-64393703 GCCCAGGAAGGCTTTAAATGTGG + Intergenic
1097856885 12:64472842-64472864 GCCCAGGACAGCTTTGAATGTGG - Intronic
1097934265 12:65227666-65227688 GCCCAGGATGGCTTTGAATGCGG + Intronic
1098277679 12:68830000-68830022 TGCCAGGATGGCTTTGAATGTGG + Intronic
1098389029 12:69949577-69949599 GCCCAGGACGGCTTTGAATGTGG + Intronic
1098411924 12:70195375-70195397 GCCCAGGATGGCTTTGAATGTGG - Intergenic
1098606896 12:72402333-72402355 GCCCAGGATGGCTTTGAATGTGG - Intronic
1098781903 12:74698230-74698252 GCCCAGGACGGCTCTGAATGAGG + Intergenic
1098897741 12:76083516-76083538 GCCCAGGACGGCTTTAAATGTGG - Intronic
1098903335 12:76135330-76135352 GCCCAGAATGGCTTTGAATATGG + Intergenic
1098942178 12:76550646-76550668 GCCCAGGACAGTTTTGAATGCGG - Intronic
1099001186 12:77179704-77179726 GCCCAGGATGGCTTCAGCTGGGG + Intergenic
1099031888 12:77536274-77536296 GCCTAGGACAGGTTTGAATGTGG + Intergenic
1099051809 12:77789916-77789938 GCCCAGGACAGCTTTGAATGTGG - Intergenic
1099205253 12:79719401-79719423 GCTCAGGATGGCTTTGAATGTGG + Intergenic
1099571337 12:84322853-84322875 TCACAAGATGGCTGTGAATGTGG - Intergenic
1099942214 12:89202120-89202142 GCCCAGAAAGTCTTTGAATGCGG - Intergenic
1100056393 12:90516404-90516426 GCCCAGGACAGTTTTGAATGTGG + Intergenic
1100235920 12:92660668-92660690 GCCCAGCATGGCTTTGGATGTGG - Intergenic
1101008803 12:100428740-100428762 GCCCAGGACAGATTTGAATGTGG - Intergenic
1101140571 12:101791541-101791563 GCCAAGGACGGCTTTGAATGCGG - Intronic
1101158525 12:101950847-101950869 GCCCAGGATGGCTTTGAATGCGG - Intronic
1101189894 12:102321783-102321805 GCCCAGGACAGCTTTGAATGAGG - Intergenic
1101291517 12:103374731-103374753 GCCCAGGACAGCTTTGAATGTGG - Intronic
1101631251 12:106497047-106497069 GCCCAGGACGGCTTCGAATGCGG + Intronic
1101671358 12:106877746-106877768 GCCCAGGACGCTTTTGAATGCGG + Intronic
1101688941 12:107056505-107056527 GCCCAGGTCAGCTTTGAATGTGG + Intronic
1101714867 12:107301892-107301914 GTCCAGGATAGCTTCGAATGTGG + Intergenic
1102052498 12:109872948-109872970 GCCCAGGACCGCTTTGAATGTGG + Intronic
1102188918 12:110971149-110971171 GCCAGGGAAGGCTTTGAATATGG - Intergenic
1102214263 12:111149200-111149222 GCCTAGGACAGCTTTGAATGTGG + Intronic
1102228298 12:111244941-111244963 GCCCAGGATGGCAGCAAATGAGG - Intronic
1102265370 12:111479647-111479669 TCCTGGGACGGCTTTGAATGTGG + Intronic
1102290932 12:111699084-111699106 GCCCAGGCTGGCCTTGAACTTGG + Intronic
1102457123 12:113077802-113077824 GGCCAGGATGGCGTTGGAGGCGG - Exonic
1102625364 12:114231277-114231299 GCCCAGGATGGCTTTGAATGTGG + Intergenic
1103118751 12:118362402-118362424 CCCCAGGATGGCTTTGAATGGGG - Intronic
1103285740 12:119799776-119799798 GCCCAGGATGGTTTTTAATGTGG + Intronic
1103338549 12:120208749-120208771 GCCCAGGATAGTTTTGAATTTGG + Intergenic
1103475601 12:121216166-121216188 GCCCAGGATGGCTTTGAATGAGG - Intronic
1103628950 12:122243703-122243725 GCCCAGGCTGGCTTGGAACTAGG - Intronic
1103860917 12:124013097-124013119 CCACAGGTTGACTTTGAATGTGG + Exonic
1103926268 12:124425025-124425047 GCCCAGGACGGCTTTAAATGCGG + Intronic
1103947378 12:124533858-124533880 GCCCAGGATGCCTTTGAATGTGG + Intronic
1104259671 12:127171130-127171152 GCTCTGGATGGATTTGAAAGTGG + Intergenic
1104410415 12:128553212-128553234 GCCCAGGACAGCTTTGAATGTGG - Intronic
1105327231 13:19381785-19381807 GCCCAGGGCAGCTTTGAATGCGG + Intergenic
1105459254 13:20568075-20568097 GCACAGGACGGCTTTGAATGTGG - Intronic
1105646371 13:22322293-22322315 CCCTAGGATGGCTTTGAATGCGG - Intergenic
1105833136 13:24183533-24183555 GCCCAAGATGGCTTTGAATGGGG + Intronic
1105836771 13:24218644-24218666 GCCCAGGGAAGCTTTGAATGTGG + Intronic
1105974012 13:25457043-25457065 GCCCAGAACGGCTTTGAACGTGG - Intronic
1106105205 13:26726958-26726980 GCCCAGGACGGCTTTGAATGCGG - Intergenic
1106244830 13:27940203-27940225 GCCCAGGACAGCTTTGGATGTGG + Intergenic
1106274715 13:28193140-28193162 GCCCAGGATGACTCTGAATGTGG - Intronic
1106573726 13:30955238-30955260 ACCCAGGATGGCTTTGAATGTGG - Intronic
1106622765 13:31387153-31387175 GCCCAGAATGGCTTTGAATGTGG + Intergenic
1106699540 13:32214372-32214394 GCCCAGGACAGCTTTGAATGTGG + Intronic
1106755261 13:32816055-32816077 GCCCAGGATGGCTTTGAATGTGG - Intergenic
1106772196 13:32972442-32972464 GCCCAGGATGGCTTCTAATGCGG + Intergenic
1106793658 13:33182655-33182677 GCCCAGGATGGCTTTGAATGTGG - Intronic
1107362022 13:39629424-39629446 GCCCAGGATGGAGTGCAATGGGG + Intergenic
1107445435 13:40466349-40466371 GCCCAGGATGGCTTTGAATGTGG - Intergenic
1107694575 13:42987507-42987529 GCTCAGGATGGCTTTGAATGTGG + Intronic
1107835645 13:44410591-44410613 ACCCAGGGTGCCTGTGAATGGGG + Intergenic
1107843013 13:44479255-44479277 GCCCAGGACAGCTTTGAATGCGG + Intronic
1107874467 13:44777971-44777993 GCCCAGGGGGACTTTGAATATGG - Intergenic
1108101398 13:46960532-46960554 GCCTGGGACGGCTTTGAATGTGG + Intergenic
1108222343 13:48248766-48248788 GCCCAGGACAGATTTGAATGTGG - Intronic
1108309493 13:49173077-49173099 GCCCAGGACAGCTTTGAATGTGG - Intronic
1108391364 13:49951079-49951101 GCCCAGGATGGCTTTGAATGTGG + Intergenic
1108481810 13:50880243-50880265 GCCCAGGATGGCTTTGGATGTGG + Intergenic
1108538083 13:51406826-51406848 GCCCAGTATGGTTTTGAATGTGG + Intronic
1108599707 13:51981927-51981949 GCCCAGGATGGCTTTGAATACGG + Intronic
1108607008 13:52049733-52049755 GCCCAGGACAGCTTTGAATGCGG - Intronic
1109044877 13:57397285-57397307 GCCCCTGCTGGCTTTGAAGGTGG - Intergenic
1109229948 13:59744448-59744470 GCCCAGGATGGCTTTGAATGTGG + Intronic
1109257525 13:60101443-60101465 ACCCAGGACGGTTCTGAATGTGG + Intronic
1109712957 13:66183086-66183108 GCCCAGGCTGGAGTTCAATGCGG + Intergenic
1109873373 13:68365964-68365986 GCCCAGAACAGCTTTGCATGTGG + Intergenic
1109987294 13:70005399-70005421 GCCCAAGATAGCTTAGAACGTGG + Intronic
1110133618 13:72038024-72038046 GCCTAGGATGGCTTTGAATGTGG - Intergenic
1110145434 13:72184963-72184985 ACCCAGGACAGCTTTGAATGTGG - Intergenic
1110253438 13:73406020-73406042 GCCCAGGACAGCTTTGAATGTGG - Intergenic
1110357199 13:74580710-74580732 GCCCAGGATGGCTTTGAATGTGG - Intergenic
1110577129 13:77070343-77070365 GCCCAGGATGGCTTTGAATGTGG + Intronic
1110969691 13:81745618-81745640 GCCCAGGCTGGCGTGCAATGGGG - Intergenic
1111176952 13:84607362-84607384 GCCCTGGATGGCTTTGGATTTGG + Intergenic
1111191524 13:84813744-84813766 GCCCAGAACGGCTTTGAATGTGG - Intergenic
1111200936 13:84935956-84935978 TTCCAGTATTGCTTTGAATGTGG + Intergenic
1111251321 13:85605437-85605459 GCCCTGGACAGCTTTGAATGCGG + Intergenic
1111520095 13:89390135-89390157 GATCAGGATGCCTTTGAATGTGG + Intergenic
1111588960 13:90318780-90318802 GCCCAGGATGGCTTTGAATGTGG + Intergenic
1111911353 13:94315884-94315906 GCCCAGGATGGCTTTGAATGCGG + Intronic
1111959988 13:94799579-94799601 ACCCAGTACGGTTTTGAATGTGG + Intergenic
1112036320 13:95499987-95500009 GCCAAGGATGGCTTTGAATGAGG - Intronic
1112115294 13:96345905-96345927 GCCCAGGACAGCTTTGAATGTGG - Intronic
1112307030 13:98284109-98284131 GCCCAGGATGGCTTTGAATGAGG + Intronic
1112323105 13:98424808-98424830 GCCCAGGACGGCTTTGAATGTGG + Intronic
1112394607 13:99017803-99017825 GCCCAGGCTGGCTTTGAATGTGG - Intronic
1112429532 13:99338396-99338418 GCCCAGGACAGCTTTCAATGTGG - Intronic
1112478983 13:99756534-99756556 GCCCAGGACAGCTTTGAATGTGG + Intronic
1112768200 13:102768855-102768877 GCCCAGGACAGCTTTGAACGTGG - Intronic
1112974864 13:105304907-105304929 GCCCAGGTTAACTTTGAATCTGG - Intergenic
1113041226 13:106105825-106105847 GCCCAGGGTGGCTTTGAATGTGG + Intergenic
1113169239 13:107480646-107480668 TCCCAGGACAGATTTGAATGAGG - Intronic
1113199885 13:107855301-107855323 GCCCGGGAGAGCTTTGAATGTGG + Intronic
1113354316 13:109563788-109563810 GCCCAGGATGGCTTTGAATGTGG + Intergenic
1113477949 13:110598678-110598700 GCCCAGGAGGGCTTTGAATGAGG + Intergenic
1113602743 13:111582204-111582226 GCCCAGGATGGCTTTAAATGTGG - Intergenic
1113694523 13:112334755-112334777 GCCCAGGATGGCTTTGAATGTGG - Intergenic
1113961696 13:114129965-114129987 GCCAAGGTTGGCCATGAATGTGG + Intronic
1114533505 14:23409506-23409528 GCCCTGGAGGGCTTGGAAAGGGG - Intergenic
1114856632 14:26454216-26454238 CCCCAGGATGGCTTTGAATGTGG - Intronic
1114953181 14:27782563-27782585 GCCCAGGACAGCTTTGAATGAGG - Intergenic
1115199526 14:30838043-30838065 GCCCAGGATGGCTTTGAATGTGG - Intergenic
1115635756 14:35288893-35288915 GCCCAGGATGGCTTTCAGTGTGG + Intronic
1115711060 14:36051143-36051165 GTCCAACATGGCTTTGAATATGG + Intergenic
1115749021 14:36469463-36469485 GCTCAGGACAGCTTTGAATTTGG + Intergenic
1116001323 14:39245445-39245467 GCCCAGGATGGCTTTGAATGTGG - Intronic
1116638990 14:47436743-47436765 GCCCAGGACAGCTTTGAATGAGG - Intronic
1116875069 14:50102980-50103002 GCCCAGGACATCTTTGAACGTGG + Intergenic
1116942549 14:50804868-50804890 GCCTAGGACAGTTTTGAATGCGG - Intronic
1116991132 14:51277964-51277986 GCCCAGGGCAGCTTTGAATGTGG + Intergenic
1117117809 14:52534338-52534360 GCTCAGGACAGCTTTGAATATGG + Intronic
1117177088 14:53155884-53155906 GCCCAGGATGGCTTTGAATGTGG - Intergenic
1117235884 14:53774094-53774116 GCCCAGGAAGGCTTTGAATGAGG + Intergenic
1117401628 14:55363683-55363705 GCCCAGGATGGCTTTGAATGTGG + Intergenic
1117695428 14:58357534-58357556 GCCCAGCATGGCCTGGAATGTGG + Intronic
1117804633 14:59478974-59478996 GCCCAGGATGGCTTTGAATGTGG - Intronic
1117846615 14:59919250-59919272 GCCCATGATCGCTTGAAATGTGG - Intergenic
1118337164 14:64863367-64863389 GCCCAGGGCAACTTTGAATGTGG - Intronic
1118391687 14:65301079-65301101 GCCCAGGACGGCTTTGGATGTGG + Intergenic
1118417797 14:65561966-65561988 ACCCAGAACAGCTTTGAATGGGG + Intronic
1118572175 14:67204803-67204825 GGTCAGGATGGCTGTGAACGTGG - Exonic
1118582743 14:67319681-67319703 GCCCAGGACGGCTTTGAATGGGG - Intronic
1118649431 14:67874352-67874374 GCCCAGGATGGCTTTGAATGTGG + Intronic
1118898558 14:69967403-69967425 GCCCAGGATCGCTTTGAATGAGG + Intronic
1118965944 14:70585492-70585514 GCCCAGGATGGCTTTGAATGTGG + Intronic
1119062491 14:71489780-71489802 GCCCAGGACAGCTTTGAATGCGG - Intronic
1119114559 14:72007495-72007517 ACCCAGGATGGCTTTGAACGTGG + Intronic
1119308376 14:73626330-73626352 GCCCAGGATGGCTTTGAATGTGG - Intergenic
1119574711 14:75709026-75709048 GCCCAGGACAGCTTTGAATGTGG - Intronic
1119661804 14:76457392-76457414 GCCCAGGATGGCTTTGAATGCGG + Intronic
1119953996 14:78775400-78775422 GCCCAGGATGGCTTTGAATGTGG + Intronic
1120049447 14:79848382-79848404 GCCCAGGACAGCTTTGAGTGTGG + Intronic
1120066995 14:80054079-80054101 GCCCAGGATGGCTTTGAATGAGG - Intergenic
1120114730 14:80601500-80601522 GCCCAGGACATCTTTGAATGTGG - Intronic
1120172832 14:81263190-81263212 GCCCATGATGGTTTTGAATGTGG + Intronic
1120291602 14:82580315-82580337 GCCCAGAATGGCTTTGAATGTGG - Intergenic
1121185093 14:91960184-91960206 ACCCAGGATGGCTCTGAGTGTGG + Intergenic
1121760897 14:96444119-96444141 GCCCAGGATGGCTTTGAATGTGG - Intronic
1122171365 14:99877984-99878006 GCTCAGGACAGCTTTGAATGTGG + Intronic
1122171799 14:99882729-99882751 GCCCAGGACGACTTTGAATGTGG - Intronic
1122937088 14:104964992-104965014 GCCCAGAACAGCTTTGAATACGG + Intronic
1123466075 15:20516993-20517015 GCCCAGGGCAGCTTTGAATGTGG - Intergenic
1123479080 15:20614550-20614572 GCCCAGGACAGCTTTGAATGAGG - Intergenic
1123638932 15:22385835-22385857 GCCCAGGACAGCTTTGAATGAGG + Intergenic
1123652039 15:22484046-22484068 GCCCAGGGCAGCTTTGAATGTGG + Intergenic
1123742459 15:23292906-23292928 GCCCAGGGCAGCTTTGAATGTGG + Intergenic
1123760866 15:23431580-23431602 GCCCAGGGCAGCTTTGAATGTGG - Intergenic
1123886194 15:24730387-24730409 GCCCAGGACGGCTTTGACTGTGG - Intergenic
1123887842 15:24745362-24745384 GCCAAGGATGGCTTTTTCTGGGG - Intergenic
1124177506 15:27440056-27440078 GCCCAGGATGGGTGGGAATCTGG - Intronic
1124276799 15:28332969-28332991 GCCCAGGGCAGCTTTGAATGTGG - Intergenic
1124305901 15:28578637-28578659 GCCCAGGGCAGCTTTGAATGTGG + Intergenic
1124390513 15:29251463-29251485 GCCCAGGACGGCTTCGAATGAGG + Intronic
1124485550 15:30111899-30111921 GCCCAAGACGGCTTTGAATATGG - Intergenic
1124518026 15:30385368-30385390 GCCCAAGACGGCTTTGAATATGG + Intronic
1124534106 15:30529730-30529752 GCCCAGGATGGCTTTGCATGTGG - Intergenic
1124540627 15:30580885-30580907 GCCCAAGACGGCTTTGAATATGG - Intergenic
1124602405 15:31146011-31146033 GCCCAGGACAGCTTTGAATGAGG - Intronic
1124758027 15:32426697-32426719 GCCCAAGACAGCTTTGAATATGG + Intergenic
1124764541 15:32477880-32477902 GCCCAGGATGGCTTTGCATGTGG + Intergenic
1125060524 15:35416198-35416220 ACCCAGGACGGCTTTGAATGCGG - Intronic
1125258778 15:37798273-37798295 GCCCAGGACAGCTTTGAATGTGG + Intergenic
1125304555 15:38295333-38295355 GCCCAGGATGGCTTTGAATGCGG - Intronic
1125315262 15:38424806-38424828 ACCCAGGATGGCTTTGAATGCGG - Intergenic
1125851885 15:42912036-42912058 GCCCAGGACGGCTTTGAATGTGG - Intronic
1126066792 15:44831887-44831909 GCCCAGGATGGCTTTGAATATGG + Intergenic
1126093039 15:45068668-45068690 GCCCAGGATGGCTTTGAATATGG - Intronic
1126228457 15:46297847-46297869 GCCCAGAATGGCTTTGAATGAGG - Intergenic
1126619220 15:50620229-50620251 GCCCAAGATGGCTTTGAATATGG + Intronic
1126698600 15:51347343-51347365 GCCCAGGATGGCTTTGAATGTGG + Intronic
1126929754 15:53634553-53634575 GCCCAGGACAGCTTTGAATGGGG - Intronic
1127218379 15:56849292-56849314 GCCCAGGATGGCTTTGAATGTGG + Intronic
1127246958 15:57187576-57187598 GCCCAGGACGGCTTTGAATGTGG - Intronic
1127369289 15:58322245-58322267 GCCCAGGACGGCTTTGAATATGG - Intronic
1127656494 15:61060901-61060923 GCCCAGGATGGCTTTGAACGTGG - Intronic
1127754031 15:62073192-62073214 GCCCAGGATGGCTTTGAATACGG + Intergenic
1128606696 15:69041792-69041814 GCCCAGGACGGCTTTGAATGTGG + Intronic
1128856410 15:71021105-71021127 ATCCAGGATGGCTTTGAACGTGG - Intronic
1128894806 15:71363044-71363066 GCCCAGGATGGCTTTGAATGTGG - Intronic
1129050010 15:72773185-72773207 GCCCAGGATGCCTTTGAATGTGG - Intronic
1129509506 15:76110362-76110384 GCCCAGGACAGCTTTGAATGCGG + Intronic
1129566254 15:76626056-76626078 GCCCAGGATGGCTTTGAATGCGG - Intronic
1129904727 15:79178423-79178445 GCCAAAGATAGCCTTGAATGAGG - Intergenic
1130066976 15:80613025-80613047 GCCCAGGACGGCTTTGAATGCGG + Intergenic
1130247586 15:82266207-82266229 GCCCAGGACAGCTTCGAATGAGG - Intronic
1130262072 15:82363224-82363246 GCCTGTGAAGGCTTTGAATGTGG + Intergenic
1130279160 15:82505783-82505805 GCCTGTGAAGGCTTTGAATGTGG - Intergenic
1130372638 15:83298805-83298827 GGCCAGGACGACTTTGAATGTGG - Intergenic
1130403308 15:83577251-83577273 GCCCAGGATGGCTCTGAATGTGG - Intronic
1130452564 15:84071301-84071323 GCCCAGGATGGCTTTGAATGAGG + Intergenic
1130622972 15:85483288-85483310 GCCTGTGAAGGCTTTGAATGTGG + Intronic
1130651981 15:85767307-85767329 GCCCAGGCTGGTCTTGAATTGGG + Intronic
1131079088 15:89519336-89519358 AGCCAGGATGGCTTTGAATGTGG + Intergenic
1131109248 15:89754534-89754556 GCCCAGGATGGCTTTGAATGTGG - Intergenic
1131244812 15:90781729-90781751 GCCCAGGATGGTTTTGAATGTGG - Intronic
1131861239 15:96655730-96655752 GCCCAGGACAGCTTTGAATGTGG - Intergenic
1131963483 15:97812900-97812922 ACCCAGGATGGCTTTGAATGAGG + Intergenic
1132173393 15:99687134-99687156 GCCCAGGCTGGTTTTGAACTGGG + Intronic
1132416580 15:101624568-101624590 GGCCAGGATGGCTTTGAATGTGG - Intronic
1132493181 16:245727-245749 GCCCAGGATGGCTTGAAGTGTGG - Intronic
1133497682 16:6335250-6335272 GAGTAGGATGGCTTTGAAGGTGG + Intronic
1133961506 16:10497615-10497637 GCCTCGGATGGCTTGGAATGTGG - Intergenic
1134022783 16:10932947-10932969 GCTCAGGACGGCTTTGACTGTGG - Intronic
1134077080 16:11299622-11299644 GGCCAGCATGGCTTTGATTCTGG + Intronic
1134643128 16:15845225-15845247 GCCCAGGACGGCTTTGAATGTGG + Intronic
1134765512 16:16754198-16754220 GCCCAAGACAGCTTTGAATGGGG - Intergenic
1134980538 16:18605014-18605036 GCCCAAGACAGCTTTGAATGGGG + Intergenic
1135043807 16:19137968-19137990 GCCCAGGATGGTTTTGAATGTGG + Intronic
1135353680 16:21751790-21751812 GGCCAGGATGGTTTGGAGTGGGG + Intronic
1135452169 16:22567918-22567940 GGCCAGGATGGTTTGGAGTGGGG + Intergenic
1135542501 16:23342718-23342740 GCCCAGGATGGCTTTGAATGTGG - Intronic
1135762620 16:25149172-25149194 GCCCAGGACTGCTTTGAATGTGG + Intronic
1135838805 16:25854880-25854902 GCCCAGGATGGCTTTGAATGTGG - Intronic
1135872237 16:26161714-26161736 GCCCAGAACAGCTTTGAATGGGG - Intergenic
1135977460 16:27118301-27118323 GCCCAGAATGGCTTTGAATGTGG + Intergenic
1136024978 16:27463324-27463346 GCCCAGGTCGGCCTGGAATGAGG - Intronic
1136042898 16:27594350-27594372 TCCCAGGATGGTTTTGGTTGTGG + Intronic
1136418414 16:30117275-30117297 GCCCAGGATGCCTGTGGATAAGG + Exonic
1136653656 16:31695552-31695574 ACCCAGGATGGCTTTCAATGTGG - Intergenic
1136985111 16:35095711-35095733 GCCCAGGACAACTTTGAACGTGG + Intergenic
1136985742 16:35102653-35102675 GCCCAGGATAGCTTTGAATGCGG - Intergenic
1137223853 16:46482651-46482673 GACCAGGAAGACTTTGAACGTGG + Intergenic
1137242952 16:46673874-46673896 GCCCAGGATGGCTTTGAATGCGG + Intronic
1137243304 16:46678377-46678399 GCCCAGGACAGCCTTGAATATGG - Intronic
1137305112 16:47191331-47191353 GCCCAGGGTGGCTTTGAATGTGG + Intronic
1137409054 16:48212490-48212512 GCCCAGGATGGCTTTGAATGTGG - Intronic
1137544811 16:49395387-49395409 ACCCAGGACGGATTTGAATGTGG + Intronic
1137656869 16:50167277-50167299 GCCCACGATGGCTTTGAATGTGG - Intronic
1137931621 16:52593356-52593378 GCCCAGGATGGCTTTGAATGCGG - Intergenic
1137942157 16:52698951-52698973 GCCTAGGATGGCATTGAATGTGG - Intergenic
1138003133 16:53303121-53303143 GCCCAGGACAGCTTTGAATGCGG + Intronic
1138027456 16:53533350-53533372 ACCTAGGACGGCTTTGAATGAGG - Intergenic
1138119056 16:54383588-54383610 GCCCAGCATGGTTTTGAATGTGG + Intergenic
1138128866 16:54461549-54461571 GTCTGAGATGGCTTTGAATGTGG - Intergenic
1138151429 16:54661173-54661195 GCCCAGGCTGGCCTTGAACTGGG + Intergenic
1138222191 16:55261217-55261239 GCCCAGGATGGCTTTGAATATGG + Intergenic
1138352930 16:56355941-56355963 GCCCGGGATGGGCTTCAATGGGG + Intronic
1138443531 16:57049178-57049200 GCCTAGGATGGCTTTGAATACGG - Intronic
1138485876 16:57343234-57343256 GCCCAGGACAGCTTTGAATGTGG - Intergenic
1138729461 16:59178813-59178835 GCCCAGGATGGCTTTGAATGTGG - Intergenic
1139047567 16:63081302-63081324 GTCCAGGACGGCTTTGAATGTGG - Intergenic
1140144667 16:72295009-72295031 GCCCAGGTTGGCTTTGAATGTGG - Intergenic
1140261189 16:73381846-73381868 GCCCGGGATGGCTTTGAATGCGG - Intergenic
1140348761 16:74241262-74241284 GCCCAGGAGGGCTTTGAATGTGG - Intergenic
1140525016 16:75615569-75615591 GCCCAGGACAGCTTTGAATGTGG - Intronic
1140690445 16:77478390-77478412 GACAAGGGTGGCTTTGAAGGTGG - Intergenic
1140803199 16:78507877-78507899 GCCCAGGACAGCTTTGAATGTGG + Intronic
1140806086 16:78533477-78533499 GCCCAGGACAACTTTGAATCTGG - Intronic
1141384682 16:83609177-83609199 GCTGAGGATGGCTTTGAATGCGG + Intronic
1141401976 16:83756482-83756504 GCCCAGAATGGCTTTGAATGCGG + Intronic
1141717983 16:85737888-85737910 GCCCAGGGTGGCTTTGAATGTGG + Intronic
1141722375 16:85763570-85763592 GCCCAGGAGGGCTTCGTAAGTGG - Intergenic
1141806112 16:86342684-86342706 GCCAAGGAGAGCTTTGAATGTGG - Intergenic
1141872335 16:86795928-86795950 GCCCAGAATGGCTTTGAATGTGG - Intergenic
1141942602 16:87287789-87287811 GCCCAGGGCAGCTTTGAATGTGG + Intronic
1142025047 16:87808048-87808070 GCCCAGTGCAGCTTTGAATGAGG - Intergenic
1142318411 16:89364700-89364722 GCCCATGGCAGCTTTGAATGTGG - Intronic
1142584900 17:966232-966254 GCCCAGGACAGCTTTGAATGGGG + Intronic
1142609789 17:1102598-1102620 GCCCAGGACTGCTTTGAATGTGG - Intronic
1142838804 17:2610686-2610708 GCCCAGGACAGCTTTGAATGTGG - Intronic
1142931532 17:3289068-3289090 ACACAGTATGGTTTTGAATGTGG + Intergenic
1142986948 17:3701159-3701181 CACAAGGACGGCTTTGAATGTGG + Intergenic
1144030862 17:11321800-11321822 GCCCAGGATGGCTTTGAATGTGG + Intronic
1144096066 17:11901811-11901833 GCCTAGGACGGCTTTGAAGGTGG - Intronic
1144274454 17:13652281-13652303 GCCCAGGATGGCTTTGAATGAGG - Intergenic
1144471955 17:15551606-15551628 GCCCAGGACAGCTTTGAATGCGG + Intronic
1144514845 17:15910260-15910282 GCCCAGGGTGGCTTTGAATGCGG + Intergenic
1144822715 17:18086805-18086827 GCCCAGGACCACTTTGAATGTGG + Intergenic
1144877020 17:18403340-18403362 GCCTAGGGCTGCTTTGAATGAGG - Intergenic
1144924523 17:18793103-18793125 GCCCAGGACAGCTTTGAATGCGG - Intronic
1145155210 17:20541068-20541090 GCCTAGGGCTGCTTTGAATGAGG + Intergenic
1145234191 17:21197211-21197233 GCCCACGATGGCTTTGAATGTGG + Intergenic
1145725517 17:27118315-27118337 GCCTAGGACAACTTTGAATGTGG + Intergenic
1145745531 17:27316955-27316977 GCCCAGGATGGCTTTGAACGTGG - Intergenic
1146070306 17:29674872-29674894 GCCCAGGATGGCTTTGCATGCGG - Intronic
1146072290 17:29694021-29694043 GCCCAAGATGGCTTTCAATGTGG + Intronic
1146084041 17:29810861-29810883 GCCCAGAATGGCTTTGAATGTGG + Intronic
1146596193 17:34171310-34171332 GCTCAGGACAGTTTTGAATGTGG - Intronic
1146992928 17:37291543-37291565 GCCCAGGACAGCTTTGGATGAGG - Intronic
1147560163 17:41503931-41503953 GCCCAGGACAGCTTTGATTGAGG - Intronic
1147712105 17:42475452-42475474 CCTCAGGACAGCTTTGAATGTGG + Intronic
1147863314 17:43536745-43536767 GCCCAGGGTAGCTTTGAATGCGG - Intronic
1148264175 17:46211453-46211475 GCCCAGGACAGCTTTGAATGTGG - Intronic
1148640106 17:49181063-49181085 GCCCAGGACGGCTTTTAATGCGG - Intergenic
1148815279 17:50323477-50323499 GCCTAGGACAGCTTTGAATGTGG + Intergenic
1149607715 17:57936470-57936492 GCCCAGGATGGCAGGGAAGGAGG + Intronic
1149893374 17:60409895-60409917 ATCCAGGACAGCTTTGAATGTGG - Intronic
1150179232 17:63097630-63097652 GACAAGGACAGCTTTGAATGTGG - Intronic
1150202008 17:63367333-63367355 TCCCCGGGAGGCTTTGAATGTGG + Intronic
1150258530 17:63769819-63769841 ACCCAGGACAGCTTTGAATGTGG - Intronic
1150364376 17:64568332-64568354 GCCCAGGACGGCTTTCAGTGTGG - Intronic
1150563493 17:66316451-66316473 GCCCAGGATGGCTTAGAATGTGG + Intronic
1150704166 17:67472721-67472743 GCCCAGGACAGCTTTGAATGTGG - Intronic
1150943083 17:69714520-69714542 GCCCAAGACAACTTTGAATGTGG - Intergenic
1151113744 17:71708983-71709005 ACCCAAGACAGCTTTGAATGTGG - Intergenic
1151636890 17:75355672-75355694 GCCCAGGATGGCTTTGAAGGCGG - Intronic
1151955502 17:77378211-77378233 GTCCAGGAAGGTTTTGAATGGGG + Intronic
1152050424 17:77970591-77970613 GCCCGGGATAGCTTTGAATGCGG + Intergenic
1152427693 17:80227251-80227273 GCCTGGGATGGCTTTGAATGTGG - Intronic
1152838017 17:82547420-82547442 GCCCAGGATGGCTTTGAATGTGG - Intronic
1153617941 18:6951579-6951601 TCACAGGAGGGCTTTGAAAGGGG + Intronic
1153662333 18:7336182-7336204 GCCCAGGACGACTTTGAACGCGG - Intergenic
1153692206 18:7605237-7605259 GCCCAGGAAGGCTTTGAATGTGG - Intronic
1153695044 18:7631577-7631599 GCCCAGGATGGCTTTGAATGTGG + Intronic
1153937835 18:9946399-9946421 GCCCATGATGGCTTTGAATCCGG + Intronic
1155037839 18:22040161-22040183 GCTCAGGACCGTTTTGAATGCGG + Intergenic
1155068577 18:22291778-22291800 GCCCAGGACAGCCTTGAATGAGG + Intergenic
1155119397 18:22802956-22802978 GCCCAGGATGGCTTTGAATGTGG + Intronic
1155551893 18:26973518-26973540 GCCCAGAATGGCGTTGAATGTGG + Intronic
1155599296 18:27525710-27525732 GCTTAGGATTGCTTTGAATTTGG + Intergenic
1155684242 18:28528376-28528398 GTTCAGGACGGCATTGAATGGGG - Intergenic
1155703845 18:28782996-28783018 GCCCAGGATGGTTTTGAATAAGG + Intergenic
1155880147 18:31136748-31136770 GCCCAGCGTGGCTTTGAATGTGG - Intronic
1156318063 18:35989592-35989614 ACCCAGGACGGCTTTGAGTGTGG - Intronic
1156355332 18:36335561-36335583 ATCCAGGACAGCTTTGAATGCGG - Intronic
1156439126 18:37166364-37166386 GCCCAGGACAGCTTTGAATGTGG + Intronic
1156520913 18:37721712-37721734 GCCCAGCCTGGCTGTGAATGTGG + Intergenic
1156703867 18:39856674-39856696 GCCCAGGATGGCTTTGAATGTGG + Intergenic
1156803610 18:41149122-41149144 GCCCAGGATGGCTTTGAATGTGG - Intergenic
1157056914 18:44240497-44240519 GCCCAGGGTGGCTTTGAATGTGG - Intergenic
1157119091 18:44891484-44891506 GCCAAGGTTGGCTTATAATGAGG - Intronic
1157313616 18:46570804-46570826 GCCCACGACGGCTTTGAATGTGG - Intronic
1157363735 18:47044261-47044283 GCCCAGGATAGCTTTGAATGTGG - Intronic
1157473471 18:48007388-48007410 GCCCAGGATGGCTTTGAATGCGG - Intergenic
1157564979 18:48673736-48673758 GCCCAGGATGGCTTTGAATATGG + Intronic
1157786253 18:50485649-50485671 GCCCAGGACAACTTTGAATGCGG + Intergenic
1157953463 18:52066802-52066824 GCCCAGGATGCCTTTGAATGTGG + Intergenic
1158019966 18:52830216-52830238 GCCCATGACCGGTTTGAATGTGG + Intronic
1158030519 18:52958911-52958933 GCCCAGGATGGCTTTGAATGTGG + Intronic
1158151884 18:54382986-54383008 GCTCAGGATGCATTTGAAAGGGG + Intronic
1158386992 18:57005865-57005887 GCCCAGGATGGCTTTGAATGTGG - Intronic
1158496117 18:57956491-57956513 GCTCAGGATTGTTTTGAATATGG + Intergenic
1158734644 18:60065826-60065848 GCCCAGAACAGCTTTGAATGTGG - Intergenic
1159250060 18:65864303-65864325 GCTGAAGATGGCTTTGAATGTGG + Intronic
1159250889 18:65875003-65875025 GCCCAGGATGGCTTTGAATTTGG + Intronic
1159440927 18:68478988-68479010 TCCCAGGATGGCTTTGAATGTGG + Intergenic
1159449193 18:68578067-68578089 GTCCAGGATGGCTTTGGATGTGG - Intergenic
1159544324 18:69819997-69820019 GCCCAGGACAGCTACGAATGTGG - Intronic
1159684540 18:71401875-71401897 TTCCTGGATGGCTTTGAAGGAGG + Intergenic
1159869753 18:73746973-73746995 GCCCAGGAAGGCTTTGAATGTGG + Intergenic
1159879849 18:73848321-73848343 GCCTAGGACAGCTTTGAATGCGG + Intergenic
1159925294 18:74263697-74263719 GCCCAGGTTGGCTTTGAACTTGG - Intronic
1160205834 18:76830700-76830722 GCCCAGGACGGCTTTGAATATGG - Intronic
1160388951 18:78515824-78515846 GCCCGAAATGGCTTTGAATGTGG - Intergenic
1160794795 19:940357-940379 GCCCAGGACGGCTGTAAATGCGG - Intronic
1161490320 19:4557718-4557740 GTCCAGGCTGGCTATGATTGAGG - Intronic
1161965877 19:7548462-7548484 GCCCAGGATGGCTTCGAATTTGG - Intronic
1162397617 19:10426342-10426364 GCCCAGGATGGCATTGAATTCGG + Intronic
1163850798 19:19662343-19662365 ACCCTGGCTGGCTCTGAATGTGG - Intronic
1163891582 19:20021167-20021189 GTCCAGGATGGCTTTGAATGTGG - Intronic
1164741497 19:30579426-30579448 GTCTAGGATGGCTTTGACTGGGG + Intronic
1165188949 19:34046165-34046187 ACCCAGGATGGCTTCGAATGAGG - Intergenic
1165256929 19:34582665-34582687 GCCCAGGGTGGCTTTCAATGCGG - Intergenic
1165265679 19:34661757-34661779 GCCCAGGACAGCTTTGAATGTGG + Intronic
1165446419 19:35859269-35859291 GCCCAGGATGGCTTTGAATGTGG + Intronic
1165664974 19:37620609-37620631 GCCCAGCAAGGCTTTGAATGCGG - Intronic
1166073242 19:40398533-40398555 GCCCACGATGGCGGGGAATGGGG + Intronic
1166200823 19:41236874-41236896 GCCCAGGATGGCTTTGAATGCGG + Intronic
1166595350 19:44043307-44043329 GCCCAGGACGGCTTTGAATGTGG + Intergenic
1166615541 19:44241622-44241644 GCCCAGGACAGCTTTGAAAGTGG + Intronic
1166953480 19:46446175-46446197 GCCCAGGATGGCTCTGAAGGTGG - Intergenic
1167106938 19:47435927-47435949 GCCATGGAGGGTTTTGAATGGGG - Intronic
1167633658 19:50640786-50640808 GCACAGGACAGCTTTGAATGCGG - Intronic
1167791361 19:51684776-51684798 GCCCAGGATGGCTTTGAATGTGG - Intergenic
1167833271 19:52045059-52045081 GCTCAGGATGGCTTTGAATGTGG - Intronic
1168021296 19:53610668-53610690 GCTCAGGATGGCTTTGAATGTGG + Intergenic
925418637 2:3692428-3692450 GCCCATGGTGGCTTTGAATGTGG - Intronic
925562087 2:5207330-5207352 ACCCAGGACGGCTTTGAATGTGG - Intergenic
925571938 2:5321746-5321768 GCCCAGGACAGCTTTGAATGTGG - Intergenic
925593530 2:5533281-5533303 GCCCAGGATGGCTTTCAATGAGG - Intergenic
925673905 2:6339933-6339955 GCCCAGAATGACTTGGAATGTGG + Intergenic
925750182 2:7082731-7082753 GCCCAGGATGGCTTTAAATGTGG - Intergenic
925827729 2:7866353-7866375 GCTCAGGACAGCTTTGAATGTGG + Intergenic
926106634 2:10156298-10156320 GCCCAGAACGGCTTTGAATGTGG - Intronic
926304031 2:11624746-11624768 GCCCAGGACAGCTTTGAATGAGG + Intronic
926314456 2:11698985-11699007 GCCAGGGATAGCTTTGAATGTGG + Intronic
926722881 2:15975158-15975180 GCCCAGGACAGCTTTGAATGTGG + Intergenic
926766744 2:16328922-16328944 GCCTAGGACGGCTTTAAATGCGG - Intergenic
926901418 2:17754654-17754676 TCCCGGGATGGCTTTGAGCGAGG - Intronic
927297959 2:21476907-21476929 GCCCAGGACTGCCTTGAATGTGG - Intergenic
927549209 2:23982401-23982423 GCCTAGGACGGCTTTAAATGTGG - Intronic
927584572 2:24289726-24289748 GCCCAGGATGGCTTTCAATGTGG + Intronic
927727561 2:25438373-25438395 GCCCAGGATGGCTTTGAATGTGG - Intronic
927873809 2:26640985-26641007 GCCCAGGACAGCTTTGAATGGGG + Intronic
927924061 2:26997291-26997313 GCCCAGGACAGCTTTGAATGTGG + Intronic
927924664 2:27002827-27002849 AGCCAGGATGGCCTTGAATTAGG - Intronic
927993283 2:27463446-27463468 GCCCAAGATGGCTTTGAATGTGG + Intronic
928467180 2:31532998-31533020 GCCCAGGACAGTTTTGGATGTGG + Intronic
928536820 2:32249197-32249219 GCCCAAGACGGCTTTGAATGTGG - Intronic
928629785 2:33179128-33179150 GCTCAGGATGGCTTTGAATGCGG + Intronic
929005032 2:37385777-37385799 ACCCAGGATGGCTTTGAATGTGG - Intergenic
929299157 2:40282176-40282198 TCCCAGCATGCCTCTGAATGAGG - Intronic
929352315 2:40972380-40972402 GCCCTGGACAGCTTTGAATGTGG - Intergenic
929396023 2:41523222-41523244 GCCTAGGATGGCTTTGAATGAGG + Intergenic
929647427 2:43641427-43641449 GCCCAGGATGGCTTTGAATGTGG + Intronic
929655772 2:43730192-43730214 GCCCCAGATGGCTTTGAATGTGG + Intronic
929972845 2:46598467-46598489 GCCCAGGATGGCTTTGAATGTGG + Intronic
930356547 2:50328139-50328161 ACCTAGGGTGGCTTTGAATGTGG + Intronic
930359166 2:50357348-50357370 GCCCAGGATGGAGTGCAATGGGG + Intronic
930650048 2:53955312-53955334 GCCCAGGATTGTTTTGAATGTGG + Intronic
930739630 2:54817703-54817725 GCCCAGGATGGCTGTGAATGCGG - Intronic
930870508 2:56166318-56166340 GCTGAGGATGGCTTTGAATGTGG - Intergenic
930906050 2:56569341-56569363 GCCCAGGACGGCTTTCAATGAGG - Intergenic
930949216 2:57116975-57116997 GCTCAGGATGGCTTTGAATGCGG + Intergenic
931004812 2:57836924-57836946 GCCCAGGGCAGCTTTGAATGTGG + Intergenic
931438096 2:62266464-62266486 GCCCAGGATGGCTTTGAATGTGG - Intergenic
931572761 2:63687135-63687157 GCCCAAGATGGCTTTCAATGTGG - Intronic
932094642 2:68836941-68836963 GCCCAGGACAGCTCTGAATGTGG - Intergenic
932148779 2:69348943-69348965 GTTTAGGATGGCTTTGAGTGTGG - Intronic
932195145 2:69776804-69776826 GCCCAGGACAGCTTTGAATCTGG - Intronic
932222208 2:70008563-70008585 GCCCAGGACAGCTTTGAATGTGG + Intergenic
932285773 2:70530554-70530576 GCCCAGGAGGGCTTTGAATGTGG - Intronic
932720596 2:74136390-74136412 GCCCATGACAGCTTTGAATGTGG + Intronic
932810224 2:74819094-74819116 GCCTAGGACAGCTTTGAATGTGG - Intergenic
932896930 2:75649342-75649364 GCCCAGGACAGCTTTAAATGTGG + Intronic
933112118 2:78416064-78416086 GCCCAGGATGGCTTTGAATGAGG + Intergenic
933444452 2:82361029-82361051 GCTCAGGATGGCTTTGAATGTGG + Intergenic
933608423 2:84408535-84408557 GCCTGTGGTGGCTTTGAATGCGG - Intergenic
933638238 2:84730617-84730639 GCCTAGGACGGTTTTGAATGTGG - Intronic
933849831 2:86357028-86357050 GCCCAGGACAACTTTGAAAGTGG - Intergenic
933994968 2:87661526-87661548 GCCCAGGACAGCTTTGAATGTGG - Intergenic
934058813 2:88275089-88275111 GCCCAGGACAGCTTTGAATGTGG - Intergenic
934101165 2:88654411-88654433 GCCCAGGATGGAGTGCAATGGGG + Intergenic
934109237 2:88726296-88726318 GCCCAAGATGGCTTTAAATGTGG + Intronic
934484146 2:94686867-94686889 GTCCAGGACAGCTTTGAATGAGG + Intergenic
934585204 2:95486415-95486437 GCCAAGGACGGCTTTGAATGTGG - Intergenic
934589556 2:95534271-95534293 GCCAAGGATGGCTTTGAACATGG - Intergenic
934594256 2:95590332-95590354 GCCAAGGACGGCTTTGAATGTGG + Intergenic
934788523 2:97035338-97035360 GCCAAGGACGGCTTTGAATGTGG - Intergenic
934978275 2:98821650-98821672 GCCCGGGGCGGCTTTGAATGTGG - Intronic
935015286 2:99176293-99176315 GCCCAGGACAGCTCTGAATGAGG + Intronic
935036157 2:99376079-99376101 GCCCAGGATGGCTTTCAATGTGG + Intronic
935083391 2:99821556-99821578 GCCCAGGACGGCTTTGAATGCGG - Intronic
935094575 2:99932136-99932158 GGCCAGGATGGCTTTGAATACGG + Intronic
935115108 2:100128587-100128609 CCCCAAGGAGGCTTTGAATGCGG + Intronic
935695626 2:105768606-105768628 GTCCAGGATGGCTTTGAATACGG + Intronic
935782420 2:106519845-106519867 GCCTGGGAGGGCTTTGAATGTGG - Intergenic
935886987 2:107632308-107632330 ACCCAGGACAGCTTTGAATGAGG + Intergenic
936004699 2:108873808-108873830 GCCCAGGATGGCTTTGAATGTGG - Intronic
936258819 2:110939715-110939737 GCCCTGGATGGCTTTGAATGTGG + Intronic
936276051 2:111098377-111098399 GCCCAGGATAACTTTGAATGTGG - Intronic
936298888 2:111289387-111289409 GCCCAGGACAGCTTTGAATGTGG + Intergenic
936527739 2:113253247-113253269 ACCAAGGATGGCCTTGAAGGGGG - Intronic
936921806 2:117696558-117696580 GCCCAAGACACCTTTGAATGTGG + Intergenic
937212391 2:120283209-120283231 GCTCAGGATGACTTTGAATGTGG + Intronic
937398609 2:121561659-121561681 GCCCAGGACAGTTTTGAATGTGG - Intronic
937457926 2:122058924-122058946 GCCTAGGATGGCTTTGAATGTGG + Intergenic
937517897 2:122676467-122676489 GCTCAGGACAGCTTTGAATGTGG + Intergenic
937563867 2:123259886-123259908 GCCCAGGATGGCTTTGAATGTGG - Intergenic
937578397 2:123453632-123453654 GCACAGGATGGCATTGAATGCGG + Intergenic
937708254 2:124946821-124946843 GCCCTGGATAGCTTTGAATGTGG - Intergenic
938225670 2:129614212-129614234 GCCCAGAATGGCTTTGAATGAGG + Intergenic
938620179 2:133043581-133043603 ACCCAGGATGGTTTTGAATATGG - Intronic
938737161 2:134196688-134196710 GCCCAGGACGGCTTTGAATGCGG + Intronic
938739150 2:134214512-134214534 GCCAAGGACAGCTTTGAATGCGG - Intronic
939054803 2:137351890-137351912 GCCCAAGACAGCTTTGAATGTGG + Intronic
939064508 2:137466420-137466442 GCCCAGGACGGCTTTAAATGTGG + Intronic
939385827 2:141496249-141496271 GCATAGTATGGCTCTGAATGTGG - Intronic
939427523 2:142058481-142058503 GGCCAGGATGGCTTTGAATGTGG + Intronic
939601721 2:144200582-144200604 GCCCAGGACAGCTTTGAATGCGG - Intronic
939687965 2:145223302-145223324 TCCCAGGATGGCTTTGAATGTGG - Intergenic
939813968 2:146871222-146871244 GTGCAGGATGGCTTTTAATGCGG - Intergenic
939977672 2:148737876-148737898 GCCCAGGACAGCTTTGAATGTGG - Intronic
940024165 2:149187802-149187824 GCCCAGGAAGGCTTTGAATGCGG - Intronic
940158442 2:150684103-150684125 GCCCAGGAAGGCTTTGAACATGG + Intergenic
940211138 2:151257649-151257671 GCCCAGGATGGAGTGAAATGGGG - Intronic
940221734 2:151359734-151359756 TGCCAGGACGGCTTTGAATGTGG - Intronic
940265378 2:151830410-151830432 CCCTAGGATGGTTTTGAATGTGG - Intergenic
940349261 2:152663287-152663309 GCCCAGGACCGCTTTGAATGTGG + Intronic
940522144 2:154764768-154764790 GCCCATGACGGCTTTGAATGAGG - Intronic
940685063 2:156838467-156838489 GCCCAGGATGGCTTTGAATGTGG - Intergenic
940896767 2:159088617-159088639 GCCCAGGACGGCTTTGAATGCGG + Intronic
941082282 2:161076035-161076057 GCCCAGGACGGCTTTGAATGTGG + Intergenic
941203014 2:162538153-162538175 GCCCAGGATGGCTTTGAATGTGG + Intronic
941226781 2:162859693-162859715 GCCCAGGAAGGCTTTGAATGTGG + Intergenic
941232540 2:162929174-162929196 GCCTAGGAAGACTTTGAATGCGG + Intergenic
941379016 2:164768354-164768376 GCCCAGGATGGTTTTGAATGTGG + Intronic
941402887 2:165053318-165053340 GCCTAGGACGGCTTTGATTGAGG - Intergenic
941444600 2:165584951-165584973 GCCCAGGACAGCTTTGAATGCGG - Intronic
941461961 2:165782447-165782469 ACCCTGGATGGCTTTGAATGTGG - Intronic
941562707 2:167068770-167068792 GCCCAGGACAGCTTTGAATGTGG + Intronic
941617129 2:167733347-167733369 GGTCAGGACAGCTTTGAATGCGG + Intergenic
941702780 2:168622321-168622343 GGCCAGGACGGCTTTGAATGCGG - Intronic
941807469 2:169723503-169723525 GCCCAGGATTGCTTTGAATGTGG + Intronic
941867106 2:170346232-170346254 ACCCAGGACAGCTTTGAATGTGG + Intronic
942206657 2:173625938-173625960 GCCCAGGATGGCTTTGAATGTGG - Intergenic
942283153 2:174388058-174388080 GCCCAGGACGGCTTTGAATGTGG - Intronic
942478492 2:176355844-176355866 GCCCAGGATGGCTTTGAATGTGG + Intergenic
942674019 2:178407432-178407454 GCCCAGGACAGCTTTGAATGTGG + Intergenic
942808063 2:179958486-179958508 GTCCAGGACAGCTTTGAATGAGG + Intronic
942891254 2:180991574-180991596 GGCCAGGATGTCTTTGATTGTGG + Intronic
943326916 2:186510796-186510818 ACCCAGAATGACTTTGAATGTGG + Intergenic
943670276 2:190652940-190652962 GCCCAGGAGGGCTTTGAATACGG + Intronic
943716348 2:191156332-191156354 GCCCAGGACAGCTTTGAGTGCGG - Intergenic
943939300 2:193970568-193970590 TCCCAGGACAGCTTTGAATGCGG - Intergenic
944105715 2:196077171-196077193 GCCCAGGACAGCTTTGAATGTGG + Intergenic
944192712 2:197020569-197020591 GCCCAGGATGGCTTTGATTGTGG - Intronic
944286704 2:197958426-197958448 GTCCAGGACAGCTTTGAATGCGG - Intronic
944791725 2:203137210-203137232 GCCCAGGATGGCTTTGAATGTGG + Intronic
944908442 2:204285741-204285763 GCCCAGGATGGCTTTGAATGTGG + Intergenic
944941085 2:204627914-204627936 CCCCAGGTTGCCTTTGAATGTGG + Intronic
944942473 2:204643539-204643561 ACGCAGGACGGCTTTGAATGAGG + Intronic
945123431 2:206483472-206483494 GACCAACATGGCTGTGAATGAGG + Intronic
945311207 2:208315769-208315791 GCCCAAGACTGCTTTGAATCTGG + Intronic
945386204 2:209203975-209203997 GCCCAGGATGGCTTTGAATATGG - Intergenic
945426853 2:209716464-209716486 GTGCAGGATGACTTTGAATGTGG + Intronic
945537847 2:211041234-211041256 GTCCAGGACAGCTTTGAATGTGG + Intergenic
945586236 2:211667159-211667181 ACCCAGGACAGCTTTGAGTGTGG - Intronic
945599867 2:211847572-211847594 GCCCAGAACAGCTTTGAATGTGG + Intronic
945620248 2:212127246-212127268 GCCCAGGATGACATTGAATGTGG + Intronic
945722132 2:213430397-213430419 GCCCAGGACAGCTTTGAATGTGG + Intronic
945767380 2:213997799-213997821 GCCCAGAATGACTCTGAATGTGG - Intronic
946021533 2:216643730-216643752 GCCCAGGAGAGCTTTGAATGTGG - Intronic
946186623 2:217984358-217984380 GCTCAGGATGGCTTTGAATGCGG + Intronic
946471259 2:219963400-219963422 GCCCAGGATGGCTTTGAATGTGG + Intergenic
946783883 2:223221969-223221991 GCCCAGGGCGGCATTGAATGTGG + Intergenic
946846162 2:223860706-223860728 GGCCAGGATGGCTCAGCATGGGG - Intronic
947186324 2:227458839-227458861 GCACAGGACAGCTTTGAATGCGG - Intergenic
947298608 2:228662942-228662964 ACCCAGGAGAGTTTTGAATGTGG + Intergenic
947922587 2:233891075-233891097 GTCCAGAATGGCTTTGATTGTGG + Intergenic
948086016 2:235248944-235248966 GCCCAGGACAGCTTTTAATGAGG - Intergenic
948285471 2:236781261-236781283 GCCCACAATGACTTTGAATGTGG - Intergenic
948898598 2:240943527-240943549 GCCCAGGATGGAGTGCAATGGGG + Intronic
948937927 2:241180468-241180490 GCCTAGGATGGCTTTGAATGAGG - Intronic
948953024 2:241267282-241267304 GCCCAGGACAGCTTTGAACATGG - Intronic
949063959 2:241978206-241978228 GCCCAGGATGGCTTTGAATGTGG + Intergenic
1169324308 20:4662944-4662966 GCCCAGGATGGCTTTGAATGAGG - Intergenic
1169642855 20:7774486-7774508 ACCCAGGACAGCTTTGAATGTGG - Intergenic
1169792892 20:9430159-9430181 GCCCAGGATGGCTTTGAATGTGG - Intronic
1169845697 20:9988852-9988874 GCCCAGGATGACTTTGAATGTGG + Intronic
1169970904 20:11268538-11268560 GCCCAGGATTGCTTTGAATGTGG + Intergenic
1170063791 20:12288574-12288596 GCCCAGGACAGCTTTGAATGTGG - Intergenic
1170253726 20:14316495-14316517 GCCCAGGATGGCTTTGAATGTGG + Intronic
1170453792 20:16513358-16513380 GGCCAGCATGGATTTTAATGTGG - Intronic
1170876190 20:20252481-20252503 GCCCAAGGTGGCTTTGAATGTGG + Intronic
1170903073 20:20484984-20485006 GCCCTGGATGACTTTGAATGTGG + Intronic
1171303041 20:24080312-24080334 GCTCAGTTTGGCTTTGAAAGTGG - Intergenic
1171387430 20:24779787-24779809 TCCCAGGATGGCCTTGTATGTGG - Intergenic
1172076584 20:32302926-32302948 GCCCAGGATGGCTTTGAATGTGG + Intronic
1172087412 20:32397769-32397791 GCCCAGGACAGCTTTCAATGCGG - Intronic
1172166254 20:32901386-32901408 ACCCAGGACAGCTCTGAATGTGG - Intronic
1172312736 20:33930896-33930918 CCCCAGGGCAGCTTTGAATGTGG + Intergenic
1172996760 20:39076437-39076459 GCCCAAGACAGCTTTAAATGTGG + Intergenic
1173372411 20:42448925-42448947 GCCCAGGATGGCTTTGAATGTGG - Intronic
1173513409 20:43648127-43648149 GCTTAGGACGGCTTTGAATGTGG + Intergenic
1173577271 20:44120803-44120825 GCCCAGGACAGCTTTGAATGTGG - Intronic
1173597277 20:44267014-44267036 GCCCAGGATGGCTTTGAATGTGG - Intronic
1173634045 20:44539369-44539391 GCCCAGGACAGCTTTGAATGAGG + Intronic
1173713542 20:45181192-45181214 GCCCAGGATGGCTTTGATTATGG + Intergenic
1173925791 20:46780235-46780257 GTCTAGGACAGCTTTGAATGTGG + Intergenic
1174403596 20:50289710-50289732 GCCCAGGATGGCTATGAATACGG - Intergenic
1174541207 20:51291159-51291181 GTTGATGATGGCTTTGAATGTGG - Intergenic
1174548164 20:51342025-51342047 TCACAGGACAGCTTTGAATGTGG + Intergenic
1175354104 20:58348854-58348876 GCCCAGGACAGCTTTGAATGTGG - Intronic
1175406204 20:58731161-58731183 GCCCAGGACAGCTTAGAGTGCGG - Intergenic
1175433518 20:58925864-58925886 GCCCAGGACAGCTTTGAATGTGG + Intergenic
1175532069 20:59680600-59680622 GCCCAGGATGGCTTTGAATGCGG + Intronic
1175554009 20:59834989-59835011 GCTCAGGACAGCTTTGAAGGAGG - Intronic
1175563389 20:59952634-59952656 GCCCAGGACAGCTTTGAAAGCGG - Intergenic
1176728925 21:10469987-10470009 GTCCAGGATGGCTTTGAATGTGG + Intergenic
1176909142 21:14541411-14541433 GCCCATGATGGCTTTGAATGTGG + Intronic
1177104102 21:16933156-16933178 GCCCAGAACAGCTTTGAATACGG + Intergenic
1177233535 21:18355276-18355298 CCTCTGGCTGGCTTTGAATGTGG + Intronic
1177245287 21:18515219-18515241 GCCCAAAACGGCTTTGAATGTGG + Intergenic
1177245291 21:18515241-18515263 GCCCAACACGGCTTTGAATGTGG + Intergenic
1177394309 21:20512821-20512843 GCCCAGGGTGGCTTTGAATGTGG - Intergenic
1177822649 21:26048476-26048498 GCCCAGGACGACTTTGAATGCGG - Intronic
1178385968 21:32150926-32150948 GCGCAGGACAGCTTTGAATATGG - Intergenic
1178401622 21:32291128-32291150 GCCCAGGATGGCTTTGAGTGTGG - Intergenic
1178455303 21:32744352-32744374 GCCCAGGACGGCTTTGAATGCGG - Intronic
1178577152 21:33804916-33804938 GCCCAGGACAGCTTTTAATGAGG - Intronic
1178608454 21:34058987-34059009 GCCCAGGATGGCTTTGAGTGTGG - Intergenic
1178674676 21:34621073-34621095 GCCCAGGGCAGCTTTGAATGTGG - Intergenic
1179087688 21:38234207-38234229 GCCCAGGATGGCTTTGAATGTGG + Intronic
1179244331 21:39617688-39617710 GCCCAGGACGGCTTTGAATGTGG + Intronic
1179336957 21:40465588-40465610 GCCCAGGACGGCTTTGAATGTGG + Intronic
1179578167 21:42320646-42320668 ACCCAGGATGGCTTTGAAGACGG + Intergenic
1179654355 21:42836100-42836122 GCCCAGGACAGCTTTGAATGCGG - Intergenic
1179777505 21:43675774-43675796 GCCCAGGGCAGCTTTGAATGTGG + Intronic
1180657827 22:17438558-17438580 GCCCAGGACGGCTTTGAATGAGG + Intronic
1180886433 22:19247947-19247969 GCCCAGTATAGCCTTGTATGTGG + Intronic
1181134870 22:20758021-20758043 GCCCAGGATGGCTTTCAATGTGG + Intronic
1181342903 22:22197023-22197045 GCCCAGAAAGGCTTTGAATGTGG + Intergenic
1181395667 22:22619451-22619473 GCCTAGGATGGCTTTGAACGTGG - Intergenic
1181663025 22:24367361-24367383 GCCCAGGACAGCTTTGAATGCGG + Intronic
1181720395 22:24769916-24769938 GCCCAGGACAGCTTAGAATGTGG - Intronic
1181838723 22:25635055-25635077 GACCACGATGGCTTTGAATGTGG + Intronic
1181888558 22:26041078-26041100 ACCCAGGACAGCTCTGAATGTGG + Intergenic
1181944143 22:26502551-26502573 GCCCAGGACGGCTCTGAATACGG + Intronic
1181958550 22:26605949-26605971 GCTCAGGATGGCTTTGAATGTGG + Intronic
1182011094 22:27001238-27001260 GTCCAGGTCGGCTTTGAATGTGG + Intergenic
1182105738 22:27687821-27687843 GCCCAGGATGGCTTTGAATGAGG - Intergenic
1182364669 22:29770422-29770444 GCCCAGGATGGCTTTGAATGAGG - Intergenic
1182436035 22:30330510-30330532 GCCCAGGAGAGCTTTGAATGTGG - Intergenic
1182702233 22:32249836-32249858 GCCCAAGCTGGCTTTGAATGTGG + Intronic
1182750143 22:32634860-32634882 GCCCAGGACAGCTTTGAATGTGG + Intronic
1183495709 22:38142674-38142696 GCCCAGGACGGCTTTGAATGTGG - Intronic
1183992172 22:41604793-41604815 GCCCAGGACAGCTTTGAAAGTGG - Intronic
1184128754 22:42504845-42504867 GACCAGGCTGGCTGTGACTGAGG + Intergenic
1184137549 22:42558160-42558182 GACCAGGCTGGCTGTGACTGAGG + Intronic
1184508713 22:44919299-44919321 GCCCAGGATGGCTTCGAATGCGG + Intronic
1185000464 22:48242420-48242442 GCCCAGGACGGCTTTCAATGTGG - Intergenic
1185335221 22:50268236-50268258 CCCCAGCCTTGCTTTGAATGGGG - Intronic
949190783 3:1245976-1245998 ACCCAGGATGGCTTTGAATGTGG - Intronic
949273075 3:2243444-2243466 GCCCAGGACAGCTTTTATTGTGG + Intronic
949343158 3:3050986-3051008 GCCCAAGATGGCTTTGAATGTGG + Intronic
949447587 3:4151767-4151789 GCCCAGGTTGGCTTTGAATGTGG - Intronic
949790371 3:7785890-7785912 GCCTGGGACAGCTTTGAATGTGG + Intergenic
949865812 3:8546345-8546367 GCCCAGGACAGCTTTGAATGTGG - Intronic
949978273 3:9480729-9480751 GCCCAGGATGGCTTTGAATGCGG - Intergenic
950047850 3:9961217-9961239 GCCCAGGACAGCTTGGTATGGGG + Intergenic
950079661 3:10212230-10212252 GCCCAGGATGGCTTTGAATGTGG + Intronic
950237401 3:11335444-11335466 GCCCAGGACAGCTTTGAGTGTGG - Intronic
950342139 3:12257176-12257198 GCCCAGAATGGCTTTGAATGTGG - Intergenic
950470477 3:13182158-13182180 GCCCATGATGGCATGGAAGGAGG - Intergenic
950567498 3:13779331-13779353 GCCCAGGACAACTTTGAATGTGG - Intergenic
950806395 3:15606852-15606874 GCCCAGGATGGCTTTGAATGCGG + Intronic
951041344 3:17991883-17991905 GCCCAGGACGGCTTTGAATGGGG + Intronic
951512678 3:23521644-23521666 GCCCAGGATGGCTTTGAATGCGG + Intronic
951573369 3:24088867-24088889 GCCCAGGACGGCTCTGAATGTGG - Intergenic
951994084 3:28707536-28707558 GTCCAGGACGACTTTGAGTGTGG + Intergenic
952242384 3:31545750-31545772 GCCCAGAGCGGCTTTGAATGTGG + Intronic
952412947 3:33065618-33065640 GCCCAGGATGGCTTTGAATGTGG + Intronic
952759582 3:36902180-36902202 GCCCAGGACAGCTTTGAATGTGG - Intronic
952795967 3:37239400-37239422 GCACAGGATGGCTTTGAATGTGG - Intergenic
952797984 3:37260224-37260246 GCCCAGGATGGCTTCGAATGAGG - Intronic
952801161 3:37293231-37293253 GCCCAGGACGGCTTTGAATGTGG + Intronic
953100598 3:39822384-39822406 GCCCAGAATGGCTTTGAATGTGG + Intronic
953284307 3:41591560-41591582 GCCCAGGACAGCTTTGAATGTGG - Intronic
953313096 3:41899537-41899559 GCCCAAGACGGCTTTGAAAGTGG + Intronic
953380577 3:42468864-42468886 GCCCAGGATGGCTTTGAATGCGG - Intergenic
953471784 3:43173580-43173602 GCCCAGGAAGGCTTTGAACGTGG + Intergenic
953567563 3:44046007-44046029 GCTCAGGGTGGCTGTGACTGGGG - Intergenic
953668294 3:44941827-44941849 GCCCAAGATGGCTTTGAATGTGG - Intronic
953796835 3:45992365-45992387 ACCCAGGATGGCTCTGAAGCTGG + Intronic
953900269 3:46836559-46836581 GCCCAGGACGGCTTTAAATGTGG - Intergenic
954013737 3:47666661-47666683 GCCCAGGATGGCGCTGAATGTGG + Intronic
954119595 3:48489133-48489155 GGCCAGGATGGCTTTGAATGTGG + Intronic
954488394 3:50876881-50876903 GCCCAGAACAGTTTTGAATGTGG + Intronic
954834233 3:53451217-53451239 GCCTAGGACAGCTTTGAATGTGG + Intergenic
955141755 3:56276899-56276921 GCCCAGGATGGTTTTGAATGTGG - Intronic
955173797 3:56591554-56591576 GCCCAAGACAGCTTTGAATGTGG - Intronic
955197054 3:56814229-56814251 TCCCAGGATGGCTTTGAATGTGG + Intronic
955217518 3:56996815-56996837 GCCCAGTACAGCTTTGAACGTGG + Intronic
955489138 3:59465017-59465039 ACCCAAGATGGCTTTGAAGGTGG + Intergenic
955510575 3:59676637-59676659 CCCCAGGGCAGCTTTGAATGTGG - Intergenic
955548053 3:60052684-60052706 GCCCCTGGTGGCTTTAAATGTGG - Intronic
955704110 3:61710543-61710565 CCCCAGGATGGCTTTGAATGAGG + Intronic
955737599 3:62056356-62056378 GCCCATGAGGGCTTTGAATGTGG + Intronic
955832550 3:63019483-63019505 GCCCAGGACAGCTTTGAATGTGG - Intergenic
955906419 3:63812350-63812372 ACCCAGGATGGCTTTGGATGTGG - Intergenic
955926279 3:64008456-64008478 GCCCACAACAGCTTTGAATGTGG + Intergenic
955943436 3:64168435-64168457 GCCCAGGATGGCTTTGAATGCGG - Intronic
956217263 3:66861346-66861368 GGCCAAGATGGCTTTGAGTGCGG - Intergenic
956278156 3:67526349-67526371 TCCCAGGATGGCTTTGAAAGTGG - Intronic
956281754 3:67564631-67564653 GCTCAGGACAGCTTTAAATGTGG + Intronic
956407027 3:68938575-68938597 CCGCAGGATGGCTTTGAATGTGG - Intergenic
956439778 3:69268968-69268990 GCCCAGGATGGAGTGCAATGGGG + Intronic
957389073 3:79538003-79538025 ACCCAGGATGGCTTCGAAAGTGG - Intronic
957566067 3:81885659-81885681 GCCCCAGATGGCTTTGAATGTGG + Intergenic
957614994 3:82515822-82515844 GCCCAGGATGGCTTTGAATGTGG - Intergenic
957688659 3:83538315-83538337 GCCCAAGATGGCTTTGAATGCGG + Intergenic
957766781 3:84635359-84635381 CCCCAGGATGGCTATCAATGTGG + Intergenic
957893400 3:86388624-86388646 GCCCAGGAAGGCTTTGAATGTGG - Intergenic
958029538 3:88090924-88090946 GCCCAAGATGGCTTTGAATGAGG - Intronic
958112312 3:89164326-89164348 GCCCAGGATGGCTTTGAATGTGG - Intronic
958476078 3:94584841-94584863 GCTCAGGACAGCTTTGAATGTGG - Intergenic
958599519 3:96277176-96277198 TCTCAGGATGGCTTTGAATGTGG - Intergenic
958609458 3:96405889-96405911 GCCCAGGACGCCTTTGAATGTGG + Intergenic
958753776 3:98225732-98225754 GCCAAAGATGGCTTTGAATGTGG - Intergenic
958810031 3:98850402-98850424 GCCCAGGACAGCTTTGAATGCGG - Intronic
958918736 3:100078961-100078983 GCCCAGGACAGCTTTGAATGTGG - Intronic
959084973 3:101842481-101842503 GCCCAGGATGGCTTTGAATGTGG + Intronic
959375241 3:105581528-105581550 CTCCAGGCTGGCCTTGAATGAGG - Intergenic
959523952 3:107355280-107355302 GCCCAGGACATCTTTGAATGTGG + Intergenic
959574735 3:107922452-107922474 GCCCAGGATGGCTTTGAATAGGG - Intergenic
960076849 3:113495982-113496004 GCTCAGGATGGCTTTGAATGTGG + Intronic
960096455 3:113695090-113695112 TCCAAGGACGGCTTTTAATGCGG - Intronic
960311506 3:116121812-116121834 GCCCCAGATGGCTTTGAATGTGG + Intronic
960378387 3:116930765-116930787 GTCCTGGACGGCTTTGAATGTGG - Intronic
960493435 3:118346666-118346688 GACCAGGATAGCTTTGAATGTGG - Intergenic
960567671 3:119151887-119151909 GTCCAGGACAGCTTTGAATGAGG - Intronic
960661668 3:120067068-120067090 GCCCAGGACAGCTTTGATTGTGG - Intronic
960692514 3:120361665-120361687 GCTCAGGATAGCTTTGGAAGCGG - Intergenic
960836248 3:121909749-121909771 GCCCAGGACAGCTTTGAATGTGG + Intronic
960927906 3:122814698-122814720 GCCCAGGATGGCTTTGAATGTGG + Intronic
960939719 3:122925751-122925773 GCCCTGGACAGCTTTGAATGAGG - Intronic
961070661 3:123921806-123921828 GCCCAGGATGGGTTTGAATGTGG - Intronic
961118145 3:124349386-124349408 GCCCATGATGGCTTTGAATACGG + Intronic
961183489 3:124894988-124895010 GCCCAGGATGGCTTTGAATGTGG - Intronic
961263394 3:125620559-125620581 GCCTAGGATGGTTTTGAATGTGG + Intergenic
961400343 3:126636854-126636876 GCCCAGGATGGCTTCAAATGTGG + Intronic
961426985 3:126856198-126856220 GCCCAGGAAGGCTTTGAATGTGG - Intronic
961482688 3:127194391-127194413 GCACAGGACGGCTTTGAATATGG - Intronic
961708945 3:128811986-128812008 GTCCAGGATGGTATAGAATGGGG + Intronic
961797980 3:129423585-129423607 GCCCAGGCTGGATTACAATGCGG - Intronic
961944367 3:130670800-130670822 GCTCAGGACAGCTTTGAATGTGG + Intronic
962174463 3:133138430-133138452 GCCCAGGACAGCTTTGAATGTGG + Intronic
962221971 3:133572154-133572176 GCCCAGGCTGGATTGCAATGAGG + Intergenic
962574679 3:136745892-136745914 GCCCAGAATGGCTTTGAATGTGG - Intronic
962593681 3:136917170-136917192 GCCCAGGACAGCTTTAAATGTGG + Intronic
962899642 3:139748723-139748745 GACCAGGATGGATTTGAATGTGG - Intergenic
963210781 3:142687286-142687308 GCCCAGGACAGCTTTGAATGTGG - Intronic
963310650 3:143706743-143706765 GCCCAGGATAGCTTTGAATGTGG + Intronic
963843646 3:150132926-150132948 GCCCAGGATGGCTTTGAATGTGG + Intergenic
964317071 3:155456393-155456415 GCCCAGGATGGCTTTGAATGTGG - Intronic
964481212 3:157140106-157140128 GCCCAGGATGGCTTTGAATGTGG - Intergenic
964578714 3:158205881-158205903 GCCCAGGACAGCTTCGAATGTGG - Intronic
964587055 3:158317952-158317974 GCCCAGAACAGCTTTAAATGTGG + Intronic
964817078 3:160728744-160728766 ACCCAGGATTGCTGTGAAGGTGG - Intergenic
964823018 3:160794841-160794863 GCCCAGGACAGCTTTGAATGAGG - Intronic
964827342 3:160843335-160843357 GCCCAGGACGGCTTTGAATGAGG + Intronic
964840768 3:160991153-160991175 GCCCAGGACGACTTTGAATGTGG - Intronic
964842317 3:161007576-161007598 GCCCAGGACAGCTTTGAATGTGG + Intronic
965206986 3:165732593-165732615 GCCCAGGATGGCTTTGAATGTGG + Intergenic
965285946 3:166820780-166820802 GCTCAGGAAGGCTTTGAAAATGG + Intergenic
965287692 3:166838343-166838365 GCCCAAGACAGCTTTGAATGAGG + Intergenic
965355903 3:167672600-167672622 GCCCAAGATGGCTTTGAATGGGG + Intergenic
965371108 3:167863592-167863614 GACCAGGATGGCTTTTAATGTGG - Intergenic
965477559 3:169176197-169176219 GCCCAAGATGGCTTTAAATGAGG - Intronic
965723259 3:171685057-171685079 GCCCGGGATGGCTTTGAATGTGG + Intronic
965883708 3:173418911-173418933 GTCCAGGATGGCTTTGAATGTGG + Intronic
965934774 3:174094397-174094419 ACCTAAAATGGCTTTGAATGTGG + Intronic
965964094 3:174466211-174466233 GCCCAAGACGGCTTTGAATGTGG + Intronic
966615722 3:181910585-181910607 GGCCAGGCTGGTCTTGAATGAGG + Intergenic
966677999 3:182609990-182610012 GCCCAGAGTGGCTTTGAGTTTGG - Intergenic
966694230 3:182773182-182773204 GCCCAGGACAGCTTTGAATGTGG - Intergenic
966823584 3:183944661-183944683 GCCCAGGACAGCTTTGAATGTGG + Intronic
967185421 3:186940523-186940545 GCCCAGGATGGCTTTGAATGCGG + Intronic
967388705 3:188934482-188934504 GCCCAGAATAGCTTTGAATTTGG + Intergenic
968144808 3:196289060-196289082 GCCCAGAACAGCTTTGCATGCGG - Intronic
968336353 3:197916952-197916974 GCCCAGGATGGCTTTGACTGGGG - Intronic
968819437 4:2838565-2838587 GCCCAGGATGCCTTTGAATGTGG + Exonic
969125864 4:4947422-4947444 GACCAGGATGGTTCAGAATGTGG + Intergenic
969187475 4:5487244-5487266 TCCCAGAATGGGTTTGACTGTGG + Intronic
969259919 4:6026796-6026818 GCCCACGGCAGCTTTGAATGTGG + Intronic
969620337 4:8275670-8275692 GCCCAGGCTTGCTTTGAGGGAGG + Intronic
969625084 4:8298208-8298230 GCCCTGGAAGGCTTTGGATTTGG - Intronic
970016330 4:11516672-11516694 GCCCAGAACAGCTTTGAATGAGG - Intergenic
970035992 4:11736760-11736782 GCCCAGGATGGCTTCGGGTGTGG - Intergenic
970221346 4:13815182-13815204 GCCCAGGACAGCTTTGAATGTGG - Intergenic
970226494 4:13863763-13863785 GCCCAGGACAGCTTTGAATGTGG + Intergenic
970302668 4:14697834-14697856 GCCCAGGACAGCTTTGAATGTGG + Intergenic
970526237 4:16934905-16934927 GCCCAGGACAGCTTTCAATGTGG + Intergenic
970693629 4:18648360-18648382 GTCCAGGATGGCTTTGAATGTGG + Intergenic
970911046 4:21276017-21276039 GCCCAGAATGGTTTTGACTGTGG - Intronic
971029655 4:22622360-22622382 GCCCAGAATGGCGTTGAATGTGG + Intergenic
971209962 4:24606718-24606740 GCCCAGGACAGCTTTGAATGCGG - Intergenic
971283205 4:25259767-25259789 GCCCAGGATGGCTTTGAATGTGG - Intronic
971416549 4:26437108-26437130 GTCCAGGATGGCTTTGAATGTGG + Intergenic
971774419 4:30943649-30943671 GCCCAGGATGACTTTGAGTGTGG + Intronic
971879544 4:32352294-32352316 ACCCAGGACAGCTTTGAATGTGG - Intergenic
972323022 4:37990260-37990282 GGCCAGGATGGTTTTGAATGTGG + Intronic
972391713 4:38619748-38619770 GCCCAGGAAAGCTTTGAATGTGG + Intergenic
972501336 4:39680802-39680824 GGCCAGGACAGCTTTGAATGTGG - Intergenic
972529331 4:39947680-39947702 ACCCAGGATGGCTTTGAATGTGG - Intronic
972594606 4:40518850-40518872 GTCCAGGATGGCTTTGAATGTGG - Intronic
972778493 4:42265501-42265523 GCCCAGGACAGCTTTAAATGTGG - Intergenic
973145422 4:46819615-46819637 GCCCAAGACAGCTTTGAATGTGG - Intronic
973248292 4:48034246-48034268 GCCCAGGACGGCTTGGAATGTGG + Intronic
973597840 4:52510851-52510873 GCCCAGGATGGCTTTGAATGTGG + Intergenic
974874213 4:67683499-67683521 GCCCAGGACAGCTTTGAATGCGG + Intronic
974967516 4:68780174-68780196 GCCCAGGACGGCTTTGAATGTGG + Intergenic
974978698 4:68924971-68924993 GCACACGATGGTTTTGAATACGG + Intergenic
975003385 4:69255134-69255156 GCCCAGGATGGCTTTGAATATGG - Intergenic
975011672 4:69362497-69362519 GCCCAGGACGGCTTTGAATATGG - Intronic
975560586 4:75704985-75705007 ACCCAGGACAGCTTTGAATGTGG + Intronic
975660629 4:76685438-76685460 GCCCAGGATAGCTTTGAATGTGG - Intronic
975783077 4:77859970-77859992 GCCCAGTATGACTTTGAATGCGG + Intergenic
976160442 4:82192881-82192903 GCCCAGGACAGCTTTGAATGTGG - Intergenic
976294073 4:83452180-83452202 GCCCAGAATGGCTTTGAATGTGG + Intronic
976426256 4:84906704-84906726 GCCCAGGAAAGCTTTGAATATGG + Intronic
976697561 4:87934499-87934521 ACCCAGGACGGCTTAGAATGTGG - Intergenic
976986810 4:91310779-91310801 GCCCAGGACAGCTTTGAATGTGG + Intronic
977055533 4:92185715-92185737 GCCCAGGACAGTTTTGAATGCGG - Intergenic
977088332 4:92634180-92634202 GCCCAGGACGGCTTTGAATGTGG - Intronic
977185769 4:93933490-93933512 GCCCAGGATGGCTTTGAATGTGG - Intergenic
977272922 4:94940241-94940263 GCCCAGGACAGCTTTGAATGCGG + Intronic
977549884 4:98429712-98429734 GCCCAGGATGATTTTGAACGTGG - Intronic
978007915 4:103640673-103640695 GCCCAGGATGGCTTTGAATGTGG + Intronic
978083667 4:104623763-104623785 GCCTAGGATGGCTTTGAATGTGG - Intergenic
978150821 4:105432650-105432672 GCCCAGGATGGCTTTCAATGTGG + Intronic
978293456 4:107174492-107174514 GCACAGGATGGCTTTGAATGTGG + Intronic
978455539 4:108886377-108886399 GCCCAGGATGGCTTTGAATATGG + Intronic
978822952 4:112987091-112987113 GCCCAGGATGGCTTTGAATGTGG - Intronic
979229179 4:118327042-118327064 GCCCAAGACGGCTTTGAATGTGG - Intronic
979277668 4:118831542-118831564 GCCCAGGACAGCTTTGAATATGG + Intronic
979491965 4:121338438-121338460 GCCTAGGAAGGCTTCGGATGTGG + Intronic
979655955 4:123194378-123194400 GCCCAACATGGCTTTGAACCTGG - Intronic
979655957 4:123194400-123194422 GCTCAGGATGGCTTTGAATTGGG - Intronic
979677602 4:123427173-123427195 GCTCAGGATGGCTTTGGCTTTGG + Intergenic
979942969 4:126785712-126785734 ACCCAGTATAGCTTTGAATGTGG - Intergenic
980104832 4:128577779-128577801 GCCCAGGATGGCTTTGAATGGGG - Intergenic
980118113 4:128700467-128700489 GCCCAGGATGGCTTTGAATGTGG + Intergenic
980339534 4:131526427-131526449 GCCCAGGATGGCTTTGAATGCGG - Intergenic
980492545 4:133547423-133547445 GCTGAAGATGGCTTTGAATGTGG - Intergenic
980515862 4:133859847-133859869 ACCCAGGATGGCTTTGAATGCGG + Intergenic
980902426 4:138917677-138917699 GCCCAGGATGGCTTTGAATGTGG - Intergenic
981180243 4:141733566-141733588 GCCCAGGACAACTTTGAATGTGG + Exonic
981237372 4:142434954-142434976 CCCCAGGATTGCTTTGAATGTGG - Intronic
981342050 4:143632869-143632891 GCCCAGGATGGCTTTGAATGTGG - Intronic
981344397 4:143658645-143658667 GCCCAGGATGGCTTTGAATGTGG + Intronic
981361760 4:143854048-143854070 GCCCAGTATGACTTTGAATGAGG - Intergenic
981361865 4:143855180-143855202 GCCCAGGAAGGCTTTGAATGTGG + Intergenic
981372491 4:143974951-143974973 GCCCAGTATGGCTTTGAATGAGG - Intergenic
981372599 4:143976084-143976106 GCCCAGGAAGGCTTTGACTGTGG + Intergenic
981381580 4:144078153-144078175 GCCCAGTATGGCTTTGAATGAGG - Intergenic
981381694 4:144079281-144079303 GCCCAGGAAGGCTTTGACTGTGG + Intergenic
981638824 4:146912168-146912190 GCCCAGGATGGCTTTGAATGTGG - Intronic
981751607 4:148097669-148097691 GCCCAGGACGGCTTTGAATGCGG + Intronic
981828569 4:148973659-148973681 ACCCAGGATGGCTTTGAATGTGG + Intergenic
981881197 4:149614788-149614810 GCCCAGGATGGCTTTAAATGAGG - Intergenic
982064521 4:151641468-151641490 GCCCAGGACAGCTTTGAATGGGG + Intronic
982534142 4:156587324-156587346 GCACAGGATGGCTTTGAATGTGG - Intergenic
982607792 4:157536818-157536840 GCCCAGGGTGGCTTTGAATGTGG - Intergenic
982703071 4:158677392-158677414 GCCCAGGATGCCTTTAAATGTGG - Intronic
983146633 4:164224107-164224129 GCCCAGGACAGCTTTGAATGAGG + Intronic
983436159 4:167718505-167718527 GCCCAGGACGGCTTTGAACATGG + Intergenic
983486334 4:168335315-168335337 GCCCAGGATGGCTTTGAATGTGG - Intergenic
983519779 4:168696090-168696112 GCCCAGGACAGCTTTGAATGTGG - Intronic
983620784 4:169758647-169758669 TCCCAGGATGGATGTGAAGGAGG - Intergenic
983628166 4:169824197-169824219 GCCCAGGATGGCTTTGAATGTGG + Intergenic
983743509 4:171165352-171165374 GCCCAGGATGGCTTTAAATGTGG + Intergenic
984144752 4:176046595-176046617 GCCCAGGCTGGCTTCAAGTGTGG + Intergenic
984172859 4:176381535-176381557 GCCCAGGGTGGCTTTGAATGTGG + Intergenic
984203289 4:176754511-176754533 GTCATTGATGGCTTTGAATGTGG - Intronic
984674261 4:182528855-182528877 ACCCAGGACAGCTGTGAATGTGG - Intronic
984687674 4:182689785-182689807 GCCCAGGACAGCTTTGAATGAGG + Intronic
984891888 4:184501709-184501731 GCCCAGGACAGCTTTGAATGTGG + Intergenic
984968711 4:185166913-185166935 GCTCAGGATGGCTTTGAATGCGG + Intronic
985089673 4:186350343-186350365 GCCCAGGACAGCTTTGAATGTGG + Intergenic
985292347 4:188399601-188399623 GCCCAGGATGGCTTTGAATGAGG + Intergenic
985309612 4:188582783-188582805 GCCCAGGATGGAGTAGAGTGGGG - Intergenic
985473203 5:59793-59815 GCCCAGGACAGCTTTGAATGTGG + Intergenic
985559067 5:572944-572966 GCCCAGGATGGCTTTGAATGCGG + Intergenic
985749589 5:1666858-1666880 GCCCAGGATGGCTCTGAATGCGG - Intergenic
985925864 5:3017951-3017973 GCCCAGGATGGCTTTGAATGTGG + Intergenic
986139120 5:5013085-5013107 GCCCAGGACAGCTTTGAATGAGG - Intergenic
986253976 5:6086449-6086471 GCCCAGGACGGCTTTGAATGTGG - Intergenic
987042652 5:14077399-14077421 GCCCAGGATGGCTTTGAACGTGG - Intergenic
987098319 5:14569762-14569784 GGCCACAATGGCTTGGAATGCGG + Intergenic
987246001 5:16049476-16049498 GCTCAGGATGGCTTTGAATGTGG + Intergenic
987376044 5:17235969-17235991 GCCCAGGACTGCTTTGAATGTGG + Intronic
987785302 5:22491695-22491717 GTCCAGGATGGCTCTGAATGTGG - Intronic
987970852 5:24941789-24941811 GACCAGGACGGCTTTGAATGTGG - Intergenic
988464780 5:31478365-31478387 GCCCAGGACGGCTTTGAATGTGG - Intronic
988527345 5:31998795-31998817 GCCCAGGATGGCTTTGAACATGG - Intronic
988547356 5:32171345-32171367 GCCCAGGATGGCTTTAAATGCGG - Intronic
988790326 5:34601932-34601954 GCCCAGGACAGCTTTGAATGTGG - Intergenic
988806050 5:34741738-34741760 GCCACGGATGGTTTTGAATAAGG + Intronic
988830591 5:34983212-34983234 GCCCAGGACAGCTTTGAATATGG + Intergenic
988901226 5:35734518-35734540 GCCCATGACAGCTTTGAATGTGG - Intronic
988932871 5:36054099-36054121 GCCCAGGACAGCTTTGAATGTGG - Intronic
989009548 5:36854955-36854977 GCCCAGGACGGCTTTGGATGTGG - Intergenic
989057052 5:37375949-37375971 GCCCAGAATGGCTTTGAATGTGG + Intergenic
989070135 5:37501562-37501584 GCCCGGAATGGCTTTGAATGTGG - Intronic
989157888 5:38361677-38361699 GCCTAGGACAGCTTTGAATGTGG - Intronic
989436397 5:41418080-41418102 GTCCAGGATGGCTTAGGATATGG + Intronic
989644959 5:43621183-43621205 GCCCAGGACGGTTTTGAATGCGG + Intronic
990321559 5:54634458-54634480 GCCCAGGATAGCTTTGAATGTGG + Intergenic
990350047 5:54907009-54907031 GCCCAGGACAGCTTTGAAATTGG - Intergenic
990403595 5:55465606-55465628 GCCCAGGATGGCTTTGAATGCGG - Intronic
990409233 5:55524325-55524347 ACCCAGGATGGCTTTGAATATGG - Intronic
990781633 5:59370978-59371000 GCCCAGGATGGCTTTGAATGTGG + Intronic
990788655 5:59451994-59452016 GCCCAGGACGGCCTTGAATGTGG + Intronic
990801410 5:59608222-59608244 GACAAGGATGGATTTTAATGTGG + Intronic
990937960 5:61170639-61170661 GACCAGGATGTCTTTAAGTGAGG - Intergenic
990992673 5:61700910-61700932 GCCCAGGACAGCTTTGAATGCGG + Intronic
991097906 5:62758773-62758795 GCCCAGGATGGCTTTGAATGTGG + Intergenic
991248897 5:64537328-64537350 ACCCAGGAAGGCTTTGAATGTGG - Intronic
991287025 5:64989108-64989130 TCCCAGCATGGCTCTGAATGAGG - Intronic
991412820 5:66361790-66361812 GCCCACGATGGCTTTGAATGTGG + Intergenic
991570024 5:68043984-68044006 GCCCATGATGGCTCTGAATGTGG + Intergenic
991634497 5:68690680-68690702 GCCCAGGATGGCTTTGAGCATGG - Intergenic
991697308 5:69285238-69285260 GCCCAGAACAGCTTTGAATGTGG - Intronic
991988871 5:72318097-72318119 GCCCAGGACAGTTTTGAATGTGG - Intronic
992014887 5:72565638-72565660 CCCCAGACTGGCTGTGAATGAGG - Intergenic
992029256 5:72704836-72704858 GCCCAGGATGGCTTTGAATATGG + Intergenic
992075392 5:73188220-73188242 GCCCAGGATGGCTTTGAATGTGG - Intergenic
992168422 5:74077590-74077612 GCCCAGGACAGCTTTGAATGTGG + Intergenic
992194963 5:74330052-74330074 GCCCAGGACAGCTTTGAATTTGG + Intergenic
992435835 5:76755396-76755418 GCCCAGGGCAGCTTTGAATGGGG - Intergenic
992552401 5:77871165-77871187 ACCCAGGACAGCTTTGAATGCGG - Intergenic
993013720 5:82512162-82512184 GACCAGGCTGGCCTTGACTGAGG + Intergenic
993064640 5:83082666-83082688 GCCTATGATGGCTTTGAATGCGG + Intronic
993199541 5:84796541-84796563 GACCAGGACGGCTTTGAATGTGG + Intergenic
993291323 5:86075325-86075347 TCCTAGGAAGGCTCTGAATGTGG + Intergenic
993321457 5:86472716-86472738 GCCCAGCATTGCTAAGAATGTGG + Intergenic
993548981 5:89250142-89250164 GCCCAGGATGGCTTTGAATGTGG - Intergenic
993877332 5:93323118-93323140 GCACAGTGTGGCTTGGAATGAGG + Intergenic
993909287 5:93661720-93661742 GCCCAGGATGGCTTTGAACGTGG - Intronic
994082532 5:95723254-95723276 GCCCAGGATGGCTTTGAATGTGG - Intronic
994111166 5:96006428-96006450 GGACAGGATGGCTTGGAATGTGG - Intergenic
994576223 5:101583030-101583052 GCCCAGGACAGCTTTGAATGAGG - Intergenic
994684250 5:102929792-102929814 CCACAGGACAGCTTTGAATGCGG + Intronic
994858970 5:105163186-105163208 GTCAAGGATGGCTTTGAATGTGG + Intergenic
994996690 5:107072656-107072678 GCCCAGAACAGCTTTGAATGTGG - Intergenic
995128428 5:108603878-108603900 GCCCAGGATGGCTTTAAATGTGG - Intergenic
995191629 5:109324278-109324300 GCCCAGGATAGCTTTGAATGTGG + Intergenic
995408613 5:111830082-111830104 GCCCAGGATGGCTTTAAATGTGG + Intronic
995727793 5:115200772-115200794 GCCCAGGATGGCTTTGAATGTGG + Intergenic
995781605 5:115781786-115781808 GCACAGGAGGGCTTTGAATGTGG + Intergenic
995956082 5:117778412-117778434 GCCCAGGATGGAGTGCAATGGGG + Intergenic
996563427 5:124855178-124855200 GCCCAGGATGGCTTTGAATGTGG - Intergenic
996650199 5:125866503-125866525 GCCCAGGATGGCATTAAATGTGG + Intergenic
996687492 5:126299659-126299681 GCCCAGGATGGCTTTGAATGCGG - Intergenic
996833391 5:127764801-127764823 GCCCAGGATGGCATGGAATGTGG - Intergenic
996863875 5:128095611-128095633 GCCCAGGACAGCTTTGAATGTGG + Intronic
996868856 5:128162873-128162895 GCCCAGGATGGCTTTGAATGCGG + Intronic
996872517 5:128207199-128207221 GCCTAGAATGGCTTTGAATGCGG - Intergenic
997079848 5:130725365-130725387 GCCCAGGACGGCTTTGAATGTGG + Intergenic
997214368 5:132098131-132098153 GCCCAGGACAGCTTTGAATGTGG - Intergenic
997352523 5:133241137-133241159 GCCCAGGAGGGCTCTAAACGTGG - Intronic
997606871 5:135181347-135181369 GCCCAGGACAGCTTTGAATGTGG + Intronic
997731564 5:136183694-136183716 GTCCAGGACAGCTTTGAATACGG + Intronic
997787568 5:136727676-136727698 ACCCAGGACAGCTTTGAATGTGG - Intergenic
997939946 5:138148245-138148267 GCCCAGGACAGCTTTGAATGTGG - Intronic
997993228 5:138563840-138563862 GCCTAGAATGGCTTTGAATGTGG - Intronic
998618440 5:143767576-143767598 GCCCAGGATGGCGTTGAATGAGG + Intergenic
998786553 5:145715982-145716004 GCCCAGGATGGCTTTGAATGTGG + Intronic
998949818 5:147382032-147382054 CCTCAGGATGGCTTTGAATGTGG - Intronic
999077770 5:148813131-148813153 ACCCAGGAAGGGCTTGAATGTGG + Intergenic
999207543 5:149860575-149860597 GCCCAGGACGGCTTTGAATGCGG + Exonic
999217719 5:149949473-149949495 CTCCAGGTGGGCTTTGAATGAGG + Intergenic
999628698 5:153547101-153547123 GCCCAACACGGCTTTGAATGAGG + Intronic
999976254 5:156914930-156914952 GCCCAGGATGGCTTTGAATGTGG + Intergenic
1000145968 5:158453608-158453630 GCCCAGGACAGATTTGAATGTGG + Intergenic
1000212978 5:159126183-159126205 GCCCAGGATGGCTTTAAATGTGG - Intergenic
1000279002 5:159765848-159765870 GCCCAGGACAGCTTTGAATGAGG - Intergenic
1000284301 5:159813508-159813530 GACCAAGATGGCTTTGAATGTGG + Intergenic
1000316957 5:160101762-160101784 GCCCAGGATGGCCTCGAACTCGG - Intronic
1000344172 5:160300468-160300490 GCCCAGGACAACTTTAAATGTGG + Intronic
1000378166 5:160603398-160603420 GCCCAGGATGGCTTTGAATGTGG + Intronic
1000383306 5:160648257-160648279 GCCCAGGGTGGCTTTGAACATGG + Intronic
1000423578 5:161064441-161064463 GCCCAGGACAGCTTTGAATGTGG - Intergenic
1000569335 5:162892715-162892737 GCCCAAGATGGCTTTGAATGTGG - Intergenic
1000594773 5:163202212-163202234 GCCCAGGATGACTTTGACTGTGG + Intergenic
1000652340 5:163832534-163832556 GCCCAGGAGGGGTTTGAATGAGG + Intergenic
1001464662 5:171952790-171952812 CCCCAGGACGGCTTTGAATGAGG + Intronic
1001658165 5:173369990-173370012 GCCCAGTCTGGCTTTGAAGATGG - Intergenic
1002201222 5:177529608-177529630 CCCAAGGATGGCTATGAAGGAGG + Intronic
1002683909 5:180991982-180992004 ACTCAGGACGGCTTTGAATACGG - Intronic
1002768011 6:259637-259659 GTCCAGGATGGCTTTGAATGCGG + Intergenic
1003105842 6:3215081-3215103 CTCATGGATGGCTTTGAATGTGG + Intergenic
1003233111 6:4272522-4272544 GCCCAGGCTGGCCTTGAACTGGG + Intergenic
1003329102 6:5114806-5114828 GTCCAGGATGGCTTTGAATGTGG - Intronic
1003354296 6:5352061-5352083 GCCCAGGATGGCTTTCAATGTGG + Intronic
1003603016 6:7535498-7535520 GCCCAGGCTGGAGTTCAATGGGG - Intergenic
1004000461 6:11592614-11592636 GCCCAGGTAGTCTATGAATGTGG + Intergenic
1004067625 6:12264677-12264699 GTCCAGGATGGCTTTGAATGTGG - Intergenic
1004159228 6:13198705-13198727 ACCCAGGACAGCTTTGAATGTGG - Intronic
1004186507 6:13425964-13425986 GCCCGGCACGGCTTTGAATGTGG - Intronic
1004235996 6:13874799-13874821 GCCCAGGACAGCTTTGAATGTGG + Intergenic
1004243961 6:13954476-13954498 TGCCAGGACAGCTTTGAATGTGG + Intronic
1004375060 6:15083916-15083938 GCCCAGGATGGCTTTGAATGGGG - Intergenic
1004489997 6:16105432-16105454 GCTAAGGATGGTTTTGAATGTGG + Intergenic
1004609176 6:17222846-17222868 GCCCGGGATGGTTTTGAATGAGG - Intergenic
1004627385 6:17389741-17389763 GCCTAGGATGCCTTTGAATGTGG + Intergenic
1004653488 6:17635046-17635068 GCTTAGGATGGCTATGAATGAGG - Intronic
1004814419 6:19297459-19297481 GCCCAGGATCGCTTTGAATGTGG - Intergenic
1004823370 6:19393897-19393919 ACCCAAGATGACATTGAATGGGG - Intergenic
1004957485 6:20745785-20745807 GCCCAGGACAGCTTTGAATGTGG - Intronic
1004974189 6:20946637-20946659 GCCCAGGCTGGAGTTCAATGAGG + Intronic
1005116205 6:22340267-22340289 GCCAAGGATGGCTTTGAATGTGG + Intergenic
1005140489 6:22626256-22626278 GCCCAGGATGGCTTTGAATGTGG + Intergenic
1005172901 6:23008640-23008662 GCCTAGGACGGCTTTGAATGTGG + Intergenic
1005356311 6:24986984-24987006 GCCCAGGATGGTTTTGAAGGCGG - Intronic
1005377238 6:25195907-25195929 GCCCAGGACAGCTTTGAATATGG - Intergenic
1005654033 6:27913758-27913780 GCCCAGGATGGCTTTGAACGTGG + Intergenic
1005718982 6:28582186-28582208 GCCCAGGACAGTTCTGAATGTGG + Intronic
1007163850 6:39814080-39814102 GCCCAGGATGGCTTTGAATGAGG + Intronic
1007179879 6:39922345-39922367 GCCTAGGATGGCTTTGAATGTGG + Intronic
1007789517 6:44301104-44301126 GACCAGGATGGGTATTAATGGGG + Intronic
1007999236 6:46341458-46341480 GCCCAGGACAGCTTTGAATTTGG - Intronic
1008390325 6:50943410-50943432 GCCCAGTACAGCTTTGAATGTGG - Intergenic
1008472867 6:51903342-51903364 GCCCAAGATGGCTTTGAATGTGG + Intronic
1008589469 6:52978874-52978896 GCTCAGGACAACTTTGAATGTGG - Intronic
1008895413 6:56548250-56548272 GCCCAGGATGGCTTTGAATGTGG - Intronic
1009737550 6:67696881-67696903 GTCGAGGAAGGCTTTGAATGTGG - Intergenic
1009930409 6:70171085-70171107 GCTCAGGAAAGCTTTGAATATGG + Intronic
1009966468 6:70583757-70583779 GCCCAGGATGGCTTTGAATGTGG - Intronic
1010111281 6:72236838-72236860 GCCCAGGATGACTTTGAATGTGG - Intronic
1010439798 6:75880543-75880565 GCCCAGGACAGCTTTGAATGAGG - Intronic
1010583330 6:77626698-77626720 GCCCAGGATGGCTTCAAATGAGG + Intergenic
1010978564 6:82343576-82343598 TTGCAGGATGGCTTTGAATGTGG - Intergenic
1011045562 6:83077926-83077948 GCCCAGAACAGTTTTGAATGTGG - Intronic
1011134920 6:84089750-84089772 TCCCAGGACAGCTTTGAATGTGG + Exonic
1011421671 6:87180213-87180235 GCCCAGGATGGCTTTGAATGCGG - Intronic
1011422742 6:87191345-87191367 GCCTAGGATGACTCTGAATGTGG - Intronic
1011651865 6:89514033-89514055 GCCCAGGATGGCTTTTCATGTGG + Intronic
1011670705 6:89680516-89680538 GCGCAGGAGGGCTGAGAATGTGG - Intronic
1011781862 6:90798449-90798471 GCCCAAGACAGCTTTGAATGTGG - Intergenic
1012451135 6:99353239-99353261 GCCCAGGACGACTTTGAATGTGG - Intergenic
1012840884 6:104327563-104327585 TCCCTTGATGGCTTTGAAGGCGG - Intergenic
1012937920 6:105387717-105387739 GCCCAGGATGGCTTTGAATGTGG - Intronic
1013280062 6:108627768-108627790 GCCTAGGATGGCTTTGAATGTGG - Intronic
1013745219 6:113337317-113337339 GCTCAGGACAGTTTTGAATGTGG - Intergenic
1013789612 6:113822175-113822197 GCCCAGAATGGCTTTGAGTGTGG - Intergenic
1014020969 6:116589408-116589430 GCCCAGGACAGCTTTGAATGTGG - Intronic
1014236919 6:118968328-118968350 GCCCAGGACAGCTTTGAATGTGG - Intronic
1014333669 6:120103235-120103257 GCCCAGGCTGGCCTTGAACTCGG - Intergenic
1014419654 6:121227119-121227141 GCCCAGGACAGCTTTGAATGTGG - Intronic
1014458355 6:121665113-121665135 CACCAGGATAGCTTTGAATGTGG + Intergenic
1014517951 6:122401974-122401996 GCCAAGGATGGGTTTGAATGCGG + Intronic
1014554984 6:122835075-122835097 GCCCAGGATGGCTTTGAATGTGG - Intergenic
1014676190 6:124369469-124369491 ACCCAGGATGGCTTTGAGTGTGG + Intronic
1014822222 6:126003203-126003225 GGCCCAGATGGCTTTGAATGTGG + Intronic
1014837498 6:126176204-126176226 GCTCAGGATTGCTTTCACTGTGG - Intergenic
1014927037 6:127284813-127284835 GCCCAGGATGGCTTTGAAAGCGG + Intronic
1015013766 6:128384495-128384517 GCCTAGGATAGCTTTGAATGTGG - Intronic
1015014021 6:128388011-128388033 GCCCAGGATAGCTTTGCATATGG - Intronic
1015036427 6:128660968-128660990 GCCCAGGACAGCTTTGAATGCGG + Intergenic
1015041090 6:128719626-128719648 GCCCTGGATGGCTTTGAATGTGG + Intergenic
1015502020 6:133944598-133944620 GCCCAGGACAGCTTTGAATGTGG - Intergenic
1015646070 6:135389940-135389962 CCACATGATGACTTTGAATGTGG + Intronic
1015681625 6:135814841-135814863 GCCCAGGACAGCTTTTAATGCGG + Intergenic
1015697060 6:135992276-135992298 GCCCAGGACAGCTTTGAATGTGG - Intronic
1015833968 6:137399295-137399317 GGCCATGATGGCTTTGTCTGAGG - Intergenic
1015916437 6:138222317-138222339 GGCCAGGACAGCTTTGAATGTGG - Intronic
1016078683 6:139829340-139829362 CCCTAGCTTGGCTTTGAATGTGG - Intergenic
1016085740 6:139911990-139912012 TCCCAGGATGGCTTTGAATGTGG - Intergenic
1016133874 6:140513304-140513326 GTCCAGGACAGCTTTGAATGTGG + Intergenic
1016247256 6:141997262-141997284 GCCCAGGATGGCTTTGAATGTGG - Intergenic
1016719819 6:147283030-147283052 GCCCAGGACAGCTTTGAATGTGG - Intronic
1016776879 6:147914083-147914105 GCCCAGGATGGCTTAGAATGAGG + Intergenic
1017099173 6:150832335-150832357 GGCCAGTATGGCTTTGTCTGTGG - Intronic
1017099806 6:150838334-150838356 GCCCATAACAGCTTTGAATGTGG + Intronic
1017177341 6:151517288-151517310 GCCCAGGATGGAGTGCAATGGGG - Intronic
1017412659 6:154185838-154185860 GCTCAGGACAGCTTTGAATGTGG - Intronic
1017867474 6:158456335-158456357 GCCCAGGACAGCTTTGAATGTGG + Intronic
1017961658 6:159227880-159227902 GCCCAGGACAGCTTTGAATGAGG - Intronic
1018268218 6:162048771-162048793 GCCCAGGATAGCTTTGAATGTGG - Intronic
1018371670 6:163174280-163174302 GCCCAGGATGGCTTTGAATGTGG - Intronic
1018406280 6:163485991-163486013 GCCCAGGAAGGCTTTGAATGTGG - Intronic
1018503860 6:164442964-164442986 GCCCAGGATGGCTTTGAATGTGG + Intergenic
1018585959 6:165359646-165359668 GCCCAAGATGACTTAGATTGTGG - Intronic
1018733992 6:166673663-166673685 GCCCAGGTCAGCTTTGAATGTGG + Intronic
1018815404 6:167326657-167326679 ACCCAGGAGAGCTTTGAATGTGG + Intronic
1019029282 6:168996208-168996230 TCCCAGCACGGCTTTGAATGTGG - Intergenic
1019667738 7:2260420-2260442 GCCCAGGACAGCTTTGAATGTGG - Intronic
1020244146 7:6417910-6417932 GCCCAGGATGGAGTGCAATGGGG + Intronic
1020354633 7:7263224-7263246 GCCCAGGACGGCTTTGAATGTGG + Intergenic
1020379098 7:7522891-7522913 GCCCAGGATGACTTTGAATGCGG - Intronic
1020384174 7:7579723-7579745 GCCCAGGACAGCTCTGAATGCGG - Intronic
1020613955 7:10435423-10435445 ATCCAGGATGGCTTTGAATGTGG - Intergenic
1020832865 7:13113020-13113042 ACCCAGGATGCCTTTGAATGTGG + Intergenic
1020902888 7:14027422-14027444 GCCTATGATGGCTTTGAATGTGG + Intergenic
1021228268 7:18054162-18054184 GCCCAGGATGGCTTTGAATGCGG + Intergenic
1021292451 7:18863352-18863374 GCCCAGGACGGCTTTGAACGTGG + Intronic
1021292456 7:18863374-18863396 GCCCAGGATGGCTTTGAACGTGG + Intronic
1021307898 7:19053917-19053939 GCCCGGAATGGCTTTGAATGTGG - Intronic
1021438637 7:20651771-20651793 GCACAAGATGGCTTTGAATGAGG + Intronic
1021468912 7:20979166-20979188 GCCCAGGACAACTTTGAATATGG - Intergenic
1021732371 7:23608402-23608424 GCATGGGACGGCTTTGAATGTGG + Intronic
1021830789 7:24606650-24606672 GCCCAGACTGGTTTTGAATTTGG + Intronic
1021854841 7:24844303-24844325 GCCCAGGATGGCTTTGAATGTGG + Intronic
1022087542 7:27083256-27083278 GCACAGGATGGCTTTGAATGTGG - Intergenic
1022345178 7:29507872-29507894 GCCCAGGACAGCTTTGAACATGG - Intronic
1022752153 7:33240461-33240483 TCCCAGGATGGCCTTGAACTTGG + Intronic
1023216730 7:37870629-37870651 GCCCAGGAAGGCTTTGAATGTGG - Intronic
1023373496 7:39534263-39534285 GCCCAGAATGGCTTTTAATGTGG - Intergenic
1023377394 7:39571177-39571199 GCCCAGGACGGCTTTGAATATGG + Intronic
1023857691 7:44194761-44194783 GCCCAGGATGCCTTGGTGTGGGG + Intronic
1023919919 7:44620681-44620703 GCCCAGGACAGCTTTGAATGTGG + Intronic
1024088037 7:45913107-45913129 GCCCAGGATGGCTTTTGCTGCGG - Intronic
1024395002 7:48856033-48856055 GGCCAGGACAGCTTTGAATGCGG + Intergenic
1024400266 7:48916642-48916664 GGCCAGGACAGCTTTGAATGCGG - Intergenic
1024682618 7:51708722-51708744 GCCCAGGACAGCTCTGAATGTGG + Intergenic
1024725944 7:52195259-52195281 GCTCAAAATAGCTTTGAATGTGG - Intergenic
1024777561 7:52805508-52805530 GCCCAGGATGGCTTTGAGTAAGG + Intergenic
1024800841 7:53076261-53076283 GCCAAGAATGGGTTTGAAAGAGG + Intergenic
1024908135 7:54411603-54411625 ACCCGGGATGGCTTTGAATGTGG - Intergenic
1025149657 7:56538747-56538769 GTCCAGCATGGCTTTGGAAGCGG - Intergenic
1025242810 7:57291955-57291977 GCCCGGGACGTCTTTGAATGTGG + Intergenic
1026115771 7:67494484-67494506 GCCCAGGATGGCTTTGAATGTGG + Intergenic
1026168196 7:67929715-67929737 GCCCAGGATGTCTTTGAATGTGG + Intergenic
1026222263 7:68410523-68410545 GCCTAGGATGGCTTTGAATGTGG + Intergenic
1026259459 7:68741718-68741740 GTCTAGGATGGCTTTGAATGTGG - Intergenic
1026426550 7:70300306-70300328 GCTCAGGACAGCTCTGAATGTGG - Intronic
1026513126 7:71044065-71044087 GCCCAGGATGTCTTTGAATGTGG - Intergenic
1026902725 7:74045991-74046013 GCCCAGGCTGGGGTGGAATGGGG - Intronic
1027409853 7:77904927-77904949 GCCCAGGATGGCTTTGAATGTGG + Intronic
1027543302 7:79495461-79495483 GCCCAGGACAGCTTTGAATGTGG + Intergenic
1027611227 7:80363466-80363488 GCCCAGGATGGCTTTGAATGAGG + Intergenic
1027647285 7:80818721-80818743 ACCCAGGACAGCTTTGAATGTGG - Intronic
1027671036 7:81099498-81099520 GCCCAGGACGGCTTTGAATGTGG - Intergenic
1027942570 7:84702997-84703019 TTCCAGAATTGCTTTGAATGTGG - Intergenic
1028136468 7:87228183-87228205 GTCCAAGATGGCTTTGAATGTGG - Intergenic
1028254595 7:88578366-88578388 GCCCAGGAGAGCTTCAAATGTGG - Intergenic
1028357620 7:89928392-89928414 GCTCAGGAAGGCTTTGAATGTGG - Intergenic
1028575647 7:92347214-92347236 GCCCAGGACAGCTTTGAATGTGG + Intronic
1028802298 7:94980251-94980273 GCCCAGGGTGGCTTTGAAAGCGG - Intronic
1028961325 7:96752504-96752526 GACCGGGATGGCTTTGAATGTGG - Intergenic
1029223084 7:99005611-99005633 GCCCACGATGCCTTTGAATGTGG + Intronic
1029332875 7:99874349-99874371 GCCTGGGAAGGCTTTGAATGTGG - Intergenic
1029884756 7:103856525-103856547 GCCCAGGCTGGAGTTCAATGGGG - Intronic
1029971993 7:104799025-104799047 GGACAGGATGTTTTTGAATGCGG - Intronic
1030017178 7:105234938-105234960 GCCCAGGACGGCTTTGAATGAGG + Intronic
1030043159 7:105469930-105469952 GCCCAGGACAGCTTTGAATGTGG - Intronic
1030098647 7:105924151-105924173 GCCCAGGATGGCTTTGAATGTGG + Intronic
1030199394 7:106887053-106887075 GCCCAGGATGGCTTTTAATGTGG - Intronic
1030307994 7:108038587-108038609 GCCCAGGACGGCTTTGAATGTGG + Intronic
1030492356 7:110253938-110253960 GCCCAAGAAAGCTTTGAATGTGG + Intergenic
1030567624 7:111179309-111179331 GCCCAGGACAGCTTTGAATATGG + Intronic
1030661542 7:112224354-112224376 GCCCAGGGCGGCCTTGAATGTGG - Intronic
1030756044 7:113289216-113289238 GCCCAGGACAGCTTTGAATGTGG - Intergenic
1031538679 7:122966170-122966192 GCCCAGGACAGCTTTGAATGTGG + Intergenic
1031603247 7:123738955-123738977 GCCCAGGATGGCTTTGAAGGTGG - Intronic
1031686775 7:124739986-124740008 GCCTAGGACGGCTTTGAATGCGG - Intergenic
1031878117 7:127164661-127164683 GCCTACGATGGCTATGAAAGAGG - Intronic
1032182616 7:129693470-129693492 ACCCAGAATGGCTTTGAATGTGG + Intronic
1032341244 7:131075371-131075393 GCCCTGGACAGCTTTGAATGCGG - Intergenic
1032343418 7:131097164-131097186 GTCCAGGACAGCTTTGAATGTGG + Intergenic
1032376015 7:131418561-131418583 GCCCAGGATGGCTTTCAATGTGG - Intronic
1032820103 7:135516469-135516491 GTCCAGGATAGCTTTGAATGTGG + Intergenic
1032871173 7:135987595-135987617 GCCCATAATGGCTTTGAATATGG - Intergenic
1032990905 7:137394213-137394235 ACCCAGGATGGATGCGAATGAGG + Intronic
1033239018 7:139661762-139661784 GCCCAGGACAGCTTTGAATGTGG - Intronic
1033273515 7:139953944-139953966 GCCCAGGATGGCATTGAATGTGG + Intronic
1033306112 7:140226981-140227003 GCCCAGGACAGCTTTGAATGTGG - Intergenic
1033344122 7:140514032-140514054 ACCCAGGACGGCTTTGAATGTGG - Intergenic
1033427555 7:141258400-141258422 GCCCAGAACACCTTTGAATGTGG - Intronic
1033713684 7:143976957-143976979 TACATGGATGGCTTTGAATGTGG + Intergenic
1033737364 7:144235999-144236021 GCCCAGGACAGCTTTGAATGTGG - Intergenic
1033745692 7:144314948-144314970 GCCCAGGACAGCTTTGAATGTGG + Intergenic
1033929198 7:146503319-146503341 GCTCAGGATGGCTTTGAATATGG + Intronic
1033969417 7:147021130-147021152 GCCCAGGATGGTTTAGAATGTGG + Intronic
1034125329 7:148666461-148666483 GCCCACGACGGCTTTGAATGTGG + Intergenic
1034601174 7:152257935-152257957 GTCCAGGATGGCTTTGAATGTGG - Intronic
1034745132 7:153517346-153517368 GCCAAGGATGACGTTGATTGTGG + Intergenic
1035197094 7:157230753-157230775 GCTCGGGATGGCTTTGAATGCGG - Intronic
1035490715 7:159274763-159274785 GCCCAGGACAGCTTTAAATGCGG - Intergenic
1035610473 8:959455-959477 GCTCATGCTGGCTTAGAATGTGG + Intergenic
1035748262 8:1977021-1977043 GCCCAGGACAGCTTTGAATGAGG + Intronic
1035842559 8:2828212-2828234 GCCCAGGGTGGCTTTGAATGTGG - Intergenic
1035891358 8:3347136-3347158 GCCCAGCACAGCTTTGACTGTGG - Intronic
1035965035 8:4181557-4181579 GCCCAGTAAGGCTTTGCATGTGG - Intronic
1036149204 8:6282485-6282507 GCCCAGGACGGCTTTGAATGAGG - Intergenic
1036475931 8:9093302-9093324 GCCCAGGACGGCTTTGAATATGG - Intronic
1036671759 8:10793514-10793536 GCCCAGGGCGGCTTTGAATGTGG - Intronic
1036975985 8:13413183-13413205 GCCCAGGACAGCTTTGAATATGG + Intronic
1037060115 8:14497468-14497490 GCCCAGGACAGCTTTGAATGTGG + Intronic
1037243923 8:16808961-16808983 GCCCAGGACGGCTTCGAATGTGG + Intergenic
1037256593 8:16962205-16962227 GCCCAGGACAGCTTTGAATGCGG + Intergenic
1037323712 8:17668149-17668171 GCCCAGGACAGCTTTGAATGCGG + Intronic
1037380614 8:18281467-18281489 ACCCAGGATTGCTTTGAATGTGG - Intergenic
1037441752 8:18923244-18923266 GCCCAGGACAGCTTTGAATGTGG - Intronic
1037717281 8:21411138-21411160 GCTCAGGCTGGCTGTGAGTGAGG - Intergenic
1037937841 8:22927340-22927362 GACCAGGAGGGCTGTGTATGTGG - Intronic
1038225295 8:25651319-25651341 GCCCAGGACAGCTTTGAATGTGG + Intergenic
1038651528 8:29407960-29407982 GCCAAGGATATCTTTGAATGTGG + Intergenic
1038661502 8:29501368-29501390 GCCCAGGACAGTTTTGAATGTGG + Intergenic
1038794175 8:30695151-30695173 GACCAGGATGACTTTGAATGTGG + Intronic
1038965113 8:32563056-32563078 TCCTAGGACAGCTTTGAATGTGG + Intronic
1039191668 8:34983171-34983193 ACCTAGGATGGCTCTAAATGTGG + Intergenic
1039318344 8:36398503-36398525 GCCCAGGACAGCTTTGAATGTGG - Intergenic
1039497858 8:37994571-37994593 GCCCAGGACAGCTTTGAACGTGG - Intergenic
1039649056 8:39320875-39320897 GCCCAGGATGGCTTTGAATGCGG - Intergenic
1039749825 8:40467587-40467609 GCCCAGGACAGCTTTGAATGAGG + Intergenic
1039759734 8:40561707-40561729 GCTCAGGATGGCTTTGAATGTGG + Intronic
1039775982 8:40737142-40737164 GCTCAGGACAGCTTTGAATGTGG + Intronic
1039789918 8:40867309-40867331 GGCCCAGATGGCTTAGAATGTGG - Intronic
1039819709 8:41124858-41124880 GACCAGGGCGGCTTTGAATGTGG + Intergenic
1039944084 8:42115324-42115346 GCCCAGGATGGCTTTGAATGTGG - Intergenic
1040419729 8:47227495-47227517 ACCCAGGACGGCTTTGAATGCGG - Intergenic
1040804615 8:51380191-51380213 GCCCAGGATGGCTTTGACTGTGG - Intronic
1040842784 8:51802404-51802426 GTCCAGGATGGCTTTGAATGTGG + Intronic
1041023632 8:53661625-53661647 GCCCAGGATGGCTTTGAATGTGG + Intergenic
1041172690 8:55161130-55161152 TCCCATGGTGGCTCTGAATGTGG + Intronic
1041476182 8:58269108-58269130 GCCTAGGATGGCTTTGAATGTGG - Intergenic
1041531651 8:58874955-58874977 GCCCAGGACAGCTTTGAATGTGG - Intronic
1041644726 8:60239553-60239575 GCCCAGGATGGCTTTGAATATGG - Intronic
1041678382 8:60560663-60560685 GCCCAGGACAGTTTTGAATGAGG + Intronic
1041896435 8:62929778-62929800 GCCCAGGGTGACTTTAAATGTGG + Intronic
1042193678 8:66213370-66213392 GCCCAGGACAGCTTTGAATGTGG + Intergenic
1042211166 8:66381842-66381864 GCCCAGGACGGCTTTGAATGCGG + Intergenic
1042211171 8:66381864-66381886 GCCCAGGATGGCTTTGAATGCGG + Intergenic
1042229451 8:66541740-66541762 GCCCCGTTTGGATTTGAATGGGG - Intergenic
1042260958 8:66858712-66858734 GCACAGGATGGTTTTGAATGCGG + Intronic
1042690871 8:71497276-71497298 GCCCAGGATGGCTTTGAATGCGG - Intronic
1042718654 8:71803459-71803481 GCCAAGCATGGTTTTGAATGTGG + Intergenic
1042729040 8:71910888-71910910 GCCCAGGATGGCTTTGATTGTGG + Intronic
1042828409 8:73001303-73001325 GCCCAGGACAGCTTTGAGTGCGG - Intergenic
1042877157 8:73449791-73449813 GCCCAGGAGGGCTTAGGGTGGGG + Intronic
1042927704 8:73983398-73983420 GCCCAGGACGGCTTTGAATGTGG + Intergenic
1042945707 8:74152733-74152755 GCCCGGAACAGCTTTGAATGTGG - Intergenic
1042951918 8:74209273-74209295 ACCCAGGATGGGTTTGAATGTGG + Intergenic
1043299565 8:78709777-78709799 ACCCAAGATGGCTTTGAATGGGG - Intronic
1043499681 8:80840244-80840266 GTCCAGGATGGCTTTGACTGTGG + Intronic
1043575264 8:81649301-81649323 GTCCAGGATAGCTTTGAATGTGG + Intergenic
1043576177 8:81660188-81660210 GCTCAGGATGGCTTTGAATGTGG - Intronic
1043632148 8:82348808-82348830 GCCCAGGATGGCTTTGAATGTGG + Intergenic
1043966914 8:86489002-86489024 GCCCAGGACAGCTTTGAATCTGG - Intronic
1044024548 8:87152508-87152530 GCCCAGGATGACTTTAACTATGG - Intronic
1044242775 8:89906350-89906372 GCCCAGGATGGCTTTGAATGTGG - Intronic
1044346330 8:91108657-91108679 GCCCAGGACGGCTTTGAATGTGG + Intronic
1044720793 8:95143947-95143969 GCCCAGGACAGCTTGGAATGTGG + Intronic
1044775177 8:95679396-95679418 GTCCAGGACAGCTTTGAATTTGG - Intergenic
1045247269 8:100453835-100453857 GCCAAGGACAGCTTTGAATACGG - Intergenic
1045384738 8:101661066-101661088 GGCCAAGATAGCTTTGAATATGG + Intronic
1045584534 8:103517982-103518004 GCCAAGGGCAGCTTTGAATGTGG - Intronic
1045584573 8:103518420-103518442 GCCCAGAAGAGCTTTGAATGAGG - Intronic
1045663794 8:104465734-104465756 GCCCAGGACAGCTTTGAATGCGG - Intronic
1046467250 8:114621437-114621459 GCCCAGGACAGCTTTGAATGTGG - Intergenic
1046476402 8:114750204-114750226 TCTCAAGATGGCTATGAATGTGG - Intergenic
1046726836 8:117684930-117684952 GACCAGGACAGCTTTGAATGTGG - Intergenic
1046773302 8:118137827-118137849 GCCCTGGATGGCTTTGAATGTGG - Intergenic
1046812018 8:118543542-118543564 GCCGAGGACAGCTTTAAATGTGG + Intronic
1046833961 8:118778909-118778931 GTCCAGGACAGCTTTGAATGTGG - Intergenic
1047005624 8:120617040-120617062 GCCCGGGACAGCTTTGAATGAGG + Intronic
1047073223 8:121371095-121371117 CCCCAGGATAGCTTTGAATGTGG - Intergenic
1047305596 8:123650367-123650389 GCCCAAGACAGCTTTGAATGCGG - Intronic
1047331786 8:123895993-123896015 GCCCAGGCTGTCTGTGAGTGTGG + Intronic
1047408401 8:124604286-124604308 CCCCAGGATGGTTTTGAATGTGG - Intronic
1047544110 8:125798291-125798313 GCCCAGGGTGGCTTTGAATGTGG + Intergenic
1047588192 8:126297588-126297610 GCCCAGGACGGCTTTGAATGTGG - Intergenic
1047848831 8:128834098-128834120 GCCCAGGATGGCTTTGAATGTGG + Intergenic
1048083536 8:131153994-131154016 GCCCAAGATGGTTTTGAATGTGG - Intergenic
1048315378 8:133357984-133358006 GCCCTGGAAGTCTTTGCATGGGG - Intergenic
1048483816 8:134829193-134829215 GCCCAGGACAGCTTTGAATGAGG + Intergenic
1048562403 8:135555305-135555327 GCCCAGGAAGGCTTTGAATGTGG + Intronic
1048800367 8:138189033-138189055 GCCATGGATGGTTTTGAATAAGG - Intronic
1049174959 8:141186452-141186474 GCCCAGGACGGCTTTGAATGAGG + Intronic
1049215821 8:141407520-141407542 GCCCAGGACGGCTTTGAATGTGG + Intronic
1049442917 8:142617351-142617373 GACCAGGTTGGCTTTGAGAGTGG - Intergenic
1049665908 8:143842403-143842425 GCCAAGGACAGCTTTGAATATGG + Intergenic
1049913191 9:290207-290229 GCCCAGGATGGCTTTGAATGTGG + Intronic
1049985506 9:947190-947212 GCCCAGAATGACTTTGAATGTGG + Intronic
1050455119 9:5827423-5827445 GTCCTGGGTAGCTTTGAATGTGG - Intronic
1050691261 9:8229332-8229354 GCCCAGGACAGCTTTGAATGTGG - Intergenic
1050749487 9:8920647-8920669 GTCTAGGATGGCTTTGAATGTGG - Intronic
1050916603 9:11142999-11143021 TCTCAAGATGGCTTTGAATGTGG + Intergenic
1050928861 9:11299912-11299934 GCCCAGGAGAGCTTTGAATGTGG - Intergenic
1050974608 9:11921359-11921381 GCCCAGGACAGCTTTGAATGTGG + Intergenic
1050976083 9:11940351-11940373 GCCCAGAACAACTTTGAATGTGG - Intergenic
1051123819 9:13780991-13781013 GCCCAGGACTGCTTTGAATGTGG + Intergenic
1051195667 9:14560983-14561005 GCCCAGGATGGCTTTGAATGCGG - Intergenic
1051389611 9:16550194-16550216 GCCCATGAAGGCTCTGAATGCGG + Intronic
1051390609 9:16559210-16559232 GCCCAGGATGGCTTTGAATGCGG + Intronic
1051446246 9:17142181-17142203 GCCCAGGATGGCTTTGAATGCGG + Intronic
1051535733 9:18155492-18155514 GTCCCGGACAGCTTTGAATGTGG + Intergenic
1051663204 9:19444556-19444578 GACCAGGATGGTTTCGAATGAGG - Intronic
1051763680 9:20498561-20498583 GCCCAAGATGGCTTTCAATGCGG + Intronic
1052185658 9:25590835-25590857 GACCAGGACAGCTTTGAATGCGG + Intergenic
1052212547 9:25923358-25923380 ACTCAGGACCGCTTTGAATGTGG + Intergenic
1052698308 9:31907273-31907295 GCCCAGGATGGCTTTGAATGTGG - Intergenic
1052768760 9:32668509-32668531 GCCCAGGATGGCTTTGAATGTGG - Intergenic
1052916011 9:33924835-33924857 GCCCATGACAGCTTTGAATGTGG + Intronic
1053079911 9:35166979-35167001 GCCCAAGACGGCTTTGAATGTGG + Intronic
1053223103 9:36327746-36327768 GCCCGGGACAGCTTTGAATGTGG - Intergenic
1053225379 9:36350857-36350879 ACCCAGGATGGCTCTGAATGTGG + Intronic
1053444923 9:38145627-38145649 GCTCAGGACAGCTTTGAATGTGG + Intergenic
1053668536 9:40336368-40336390 GGTCAGGACAGCTTTGAATGTGG - Intergenic
1053673646 9:40397525-40397547 GTCCAGGACAGCTTTGAATGAGG - Intergenic
1053923446 9:43023883-43023905 GTCCAGGACAGCTTTGAATGAGG - Intergenic
1054384746 9:64537591-64537613 GTCCAGGACAGCTTTGAATGAGG - Intergenic
1054510983 9:65978766-65978788 GTCCAGGACAGCTTTGAATGAGG + Intergenic
1054516075 9:66039926-66039948 GGTCAGGACAGCTTTGAATGTGG + Intergenic
1054883603 9:70171894-70171916 GCCCAGAACAGCTTTGAATATGG - Intronic
1054971229 9:71090018-71090040 GTCCAGGATGGCTTTGAATGTGG - Intronic
1055313361 9:75008238-75008260 GCCCAGGACAGCTTTGAATGTGG - Intronic
1055351371 9:75392463-75392485 GCCCAGGACAGCTTTGAATGTGG - Intergenic
1055451930 9:76438854-76438876 GCCCAGGAGGGCTTTCAATGAGG - Intronic
1055664136 9:78536289-78536311 GCCCAGGACAGCTTTGAATGAGG - Intergenic
1055677901 9:78684039-78684061 GCCCAGGATGGCTTTGAATGTGG - Intergenic
1055761614 9:79614728-79614750 GCCCAGGATAGCTTTGAAAGTGG + Intronic
1055830666 9:80374793-80374815 GCCCAGGATGATTTTGAATGTGG + Intergenic
1056154713 9:83822801-83822823 GCCCAGGATGACTTTGAATGTGG - Intronic
1056342184 9:85647311-85647333 ACCCAGATTGACTTTGAATGTGG - Intronic
1056355514 9:85797775-85797797 GCCCAGGATGACTTTGAATGTGG - Intergenic
1056370234 9:85946607-85946629 GCCCAGGATGGCTTTGAATGTGG + Intronic
1056493429 9:87131209-87131231 GCCCAGGACAGCTTTGAATGTGG - Intergenic
1056567715 9:87789585-87789607 GCACAGGAGGGCTTTGACAGAGG - Intergenic
1056925955 9:90834680-90834702 GTCCAGGATAGCTATGAATGTGG + Intronic
1057030154 9:91769236-91769258 GCCCAGGGTGGATGTGGATGTGG + Intronic
1057036011 9:91812118-91812140 GCCAAGGATAGCTTTGAATGTGG - Intronic
1057108123 9:92440436-92440458 GCCCAGGATGGCTTTGAATGTGG - Intronic
1057120251 9:92565363-92565385 GCCCAGGATGACTTTGAATGAGG - Intronic
1057474458 9:95386821-95386843 GCCCAAGACAGCTTGGAATGTGG + Intergenic
1057563585 9:96148192-96148214 GCCCAGGACGGCTTTGAAAGTGG + Intergenic
1057741193 9:97712745-97712767 GCCCAGGATAGCTTTGAATGCGG + Intergenic
1057788706 9:98108325-98108347 GCCCAGCACAGCTTTGAATGTGG + Intronic
1057981320 9:99666591-99666613 GCCCAGGACATCTTTGAATGTGG - Intergenic
1058033347 9:100224111-100224133 GCCCAGGATGGCTTTGAATGTGG - Intronic
1058072992 9:100620114-100620136 GCCCAGGACGGCTTTGAATGTGG - Intergenic
1058130049 9:101241484-101241506 GCTCAGGACGGCTTTGAATGTGG - Intronic
1058200933 9:102039528-102039550 GCCCTGGATGGCTTTGAATGTGG - Intergenic
1058278834 9:103085203-103085225 GCCCAGGATAGTTCTGAATGTGG - Intergenic
1058586664 9:106514454-106514476 GCTCAGGAAGGCTTTGAATGTGG - Intergenic
1058773934 9:108265655-108265677 TCCCAGGAAGGCTATGGATGGGG - Intergenic
1059147558 9:111914424-111914446 GGTAAGCATGGCTTTGAATGCGG - Intronic
1059188137 9:112295957-112295979 GCCCAGGACAGCTTTGAATGCGG + Intronic
1059391159 9:114000415-114000437 GACCAGGATGGCTTTGAATGCGG + Intronic
1059521760 9:114949218-114949240 GCCCAGGACGGCTTTGAATGTGG + Intergenic
1059606088 9:115837997-115838019 GCCCAGCATGGCTTTGAATGTGG + Intergenic
1059703034 9:116794443-116794465 GCTCAGGATGGCTTTGAATGTGG - Intronic
1059813353 9:117882288-117882310 GCCCAGGATCACTTTGAATGTGG - Intergenic
1059914089 9:119079013-119079035 GCCCAGGATGGTTTTGAGTATGG + Intergenic
1060057490 9:120427315-120427337 GCCCAGGACGGCATTGAATGTGG - Intronic
1060118016 9:120960595-120960617 GCCCAGGGCAGCTTCGAATGCGG + Intronic
1060308211 9:122435295-122435317 TCACAGGTTGGCTTTGAGTGTGG - Intergenic
1060354947 9:122897162-122897184 GCCCAGGACATCTTTGAATGCGG - Intronic
1060457292 9:123810652-123810674 GCCCAGGATGGCTTTCAATGTGG - Intronic
1060482240 9:124023367-124023389 GCCCAGGAGGGCTTTGAATGTGG - Intronic
1060571665 9:124646726-124646748 ACCCAGGATGGCTTTGAATGTGG - Intronic
1060625933 9:125111482-125111504 ACCCAGGATGGCTTTGAATGTGG + Intronic
1061350055 9:130056976-130056998 GCCCAGGATGGCTTTGAATGCGG - Intronic
1061358061 9:130121400-130121422 CCCCAGGACAGCTTTGAATGCGG - Intronic
1061411972 9:130426688-130426710 ACCCAGAACAGCTTTGAATGCGG + Intronic
1061472883 9:130841451-130841473 GCCCAGGACGGCTTTGAATGTGG - Intronic
1061659544 9:132119751-132119773 GCCCATGATGGCTTTCAGTGTGG - Intergenic
1061966538 9:134017518-134017540 GCCCAGCACAGCTTTGAATGTGG + Intergenic
1203781361 EBV:102754-102776 GCCCACGATGGCCTTGAGAGGGG - Intergenic
1203585321 Un_KI270746v1:64080-64102 GTCCAGGATGGCTTTGAATGTGG - Intergenic
1185804748 X:3047022-3047044 GCTTAGGACAGCTTTGAATGTGG - Intronic
1185955255 X:4482311-4482333 GCCCAGGACAGCTTTGAATATGG - Intergenic
1185967880 X:4628283-4628305 GCCCAGGATGGCTTTGAATGAGG + Intergenic
1186344186 X:8674656-8674678 GCCCAGGACGGCTTTGAATGCGG - Intronic
1186454653 X:9701656-9701678 GTCCAGGATGGCTTTGAATGTGG - Intronic
1186741698 X:12524879-12524901 CCCCAGGACAGCTTTGAATGTGG + Intronic
1186743790 X:12545193-12545215 GCCCAGGACAGCTTCGAATGTGG + Intronic
1186775115 X:12856998-12857020 GCCCAGGACAGCTTTGAATGCGG - Intergenic
1186844985 X:13521859-13521881 GCCCAGGATGGCTTTGAATGTGG + Intergenic
1187013488 X:15303406-15303428 GCCCAGGATGGCTGTGAATGTGG - Intronic
1187027052 X:15446537-15446559 GCCCAGGACAACTTTGAATATGG - Intronic
1187043927 X:15626469-15626491 GCCCAGGGCAGCTTTGAATGTGG + Intergenic
1187095060 X:16139391-16139413 GCCCGGGATGGCTTTGAATACGG + Intronic
1187143195 X:16614166-16614188 GCCCAGGGTGGATTTGAATGTGG - Intronic
1187274826 X:17808019-17808041 GGCCCAGACGGCTTTGAATGCGG + Intronic
1187345737 X:18462008-18462030 GCCCAGGATGGCTTTGAATGTGG + Intronic
1187408772 X:19028719-19028741 GCGCAGGACAGCTTTGAATGTGG - Intronic
1187413547 X:19072098-19072120 GCCCAGGATGGTTTTGAATGTGG + Intronic
1187458805 X:19466926-19466948 GCCCAGGATGGCTTTGAATGTGG + Intronic
1187733416 X:22279749-22279771 GTCTAGGATGGCTTTGAATGGGG - Intergenic
1188258948 X:27999760-27999782 GCCCGGGACGGCTTTGAATGGGG - Intergenic
1188359828 X:29239650-29239672 GCCCAGGATGGCTTTGAATGAGG + Intronic
1188471994 X:30551483-30551505 GCCTGGAATGACTTTGAATGTGG + Intergenic
1188538253 X:31220824-31220846 GCCCAGGATGGCTTTGAATGAGG + Intronic
1188585491 X:31769661-31769683 TCCCAGGATGGCTTTGAATGTGG - Intronic
1188649359 X:32612388-32612410 ACCCAGGATGGCTTTCAATGTGG + Intronic
1188745694 X:33839793-33839815 GCTCAGGATGACTTTGAATGCGG + Intergenic
1188979254 X:36712485-36712507 GCCCAGGACGGTTTTGAATGAGG - Intergenic
1189075437 X:37909409-37909431 GCCCATGACAGCTTTGAATGTGG + Intronic
1189151053 X:38707185-38707207 GTCCAGGATGGCTTTGAATGTGG - Intergenic
1189156767 X:38765718-38765740 GCCCAGGATGGCTTTGAATGTGG - Intergenic
1189156880 X:38766957-38766979 GCCCAGGATGGCTTTTAATGTGG + Intergenic
1189427486 X:40914128-40914150 ACCCAGGACGGCTTTGAATGTGG + Intergenic
1189720889 X:43916169-43916191 ACCCAGGACAGCTTTGAATATGG + Intergenic
1189920097 X:45895157-45895179 GCCTGGGACAGCTTTGAATGTGG + Intergenic
1189973391 X:46439889-46439911 GCCCAGGATGCCCTTGAGGGGGG + Intergenic
1189983447 X:46532919-46532941 GCCCAGGATGGCTTTGAATGCGG - Intronic
1190069406 X:47267026-47267048 GCCCAGGACGGCTTTGAATGAGG + Intergenic
1190077419 X:47328036-47328058 ACCCAGAACGGCTTTGAATGTGG - Intergenic
1190149601 X:47933169-47933191 GCCCAGGATGGCTTTCAGTGTGG - Intronic
1190251653 X:48731449-48731471 GCCCAGGACGGCTTTGAATGTGG + Intergenic
1190366915 X:49703857-49703879 GCCCAGGATGGCTTTGAATTTGG - Intergenic
1190393297 X:49954280-49954302 GTCCAGTACAGCTTTGAATGTGG + Intronic
1190477317 X:50840892-50840914 ACCCAGGATGGCTTTGAATGTGG + Intergenic
1192095628 X:68207624-68207646 GCCGTGGATGGTTTTTAATGAGG - Intronic
1192245710 X:69369908-69369930 GCCCAGGACAGCTTTGAATGTGG + Intergenic
1192314262 X:70039830-70039852 GGCCAGGATGGCTTTGAATGGGG - Intergenic
1193319415 X:80104052-80104074 GGCCAGGATGGCTTTGAATGTGG + Intergenic
1193418374 X:81252680-81252702 GCCCAGGACGGCTTTGAATGTGG - Intronic
1193422254 X:81295576-81295598 GCCCAGGACAGCTTTGAATGTGG - Intronic
1194066371 X:89267016-89267038 GCTCAGGATGCATTTGAAAGGGG + Intergenic
1194361642 X:92959043-92959065 GCTCAGGGCAGCTTTGAATGTGG - Intergenic
1194649645 X:96499744-96499766 TCTCAGGATGGCTTTGAATGTGG - Intergenic
1194843214 X:98770874-98770896 GCCCAGGACAGCTTCAAATGTGG - Intergenic
1195053088 X:101116229-101116251 GCCCAGGATTGCTCTGAATGAGG + Intronic
1195403268 X:104484560-104484582 GCCCAGGATGGCTTTGAATGTGG + Intergenic
1195544803 X:106102202-106102224 GCCCAGGATGTTTTTGAATGTGG + Intergenic
1195777935 X:108428231-108428253 GCCCAGGACGGCTTTGAATGCGG - Intronic
1195939229 X:110153711-110153733 GCCTAGGATGGATTTGAATGTGG + Intronic
1196105438 X:111890257-111890279 GCCCAGGACAGCTTTGAATACGG + Intronic
1196108369 X:111919864-111919886 GCCCAAGACAGCTTTGAATGTGG - Intronic
1196436796 X:115682000-115682022 GCCTGGAATGGCTTTGAATGTGG - Intergenic
1196753418 X:119137615-119137637 GCCCAGGATGGCTTTGAATGTGG + Intronic
1196783786 X:119404885-119404907 GCCCGGGATGGCTTTGAATGTGG - Intronic
1197128957 X:122981548-122981570 GCCCAGGAGAGCTTTGAATGTGG + Intergenic
1197470080 X:126856216-126856238 GGCCTGGATGGCTTTGAAACTGG + Intergenic
1197739391 X:129877666-129877688 GCCCAGGGCGGCTTTGAATGTGG + Intergenic
1198070506 X:133143694-133143716 ACCCAGGATAGTGTTGAATGCGG - Intergenic
1198077370 X:133206525-133206547 GCTCAGGATGGCTTTGAATGTGG + Intergenic
1198082119 X:133250088-133250110 GCTCGGGACAGCTTTGAATGTGG + Intergenic
1198125423 X:133638896-133638918 TCCCAGGACAGCTTTGAATGCGG - Intronic
1198131887 X:133704027-133704049 GCCCAAGATGGCTTTGAATGTGG - Intronic
1198209557 X:134504449-134504471 ACCCGGGATGGCTTTAAACGTGG - Intronic
1198230805 X:134687320-134687342 GCCCAGGATGGCTTTGAATGGGG + Intronic
1198435739 X:136615334-136615356 GCCCAGGACAGCTTTGAATGTGG + Intergenic
1198500859 X:137245066-137245088 ACCAAGGATGGCTTTTAATGTGG - Intergenic
1198646775 X:138816690-138816712 GCCCAGGACAGCTTCGAATGTGG + Intronic
1198672593 X:139097372-139097394 GCCCAGGATGGCTTTGAATGTGG - Intronic
1198965355 X:142222990-142223012 GCCCAGGACAGCTTTGAATGTGG - Intergenic
1199022985 X:142904380-142904402 GCCCAGGATGTCTTTGAATGTGG - Intergenic
1199213796 X:145244547-145244569 GCCCAGGACAGCTTTGAATGTGG + Intergenic
1199342470 X:146697695-146697717 GCCCAGAAAAGCTTTGAAAGTGG - Intergenic
1199393073 X:147304616-147304638 GCCCGGGACAGCTTTGAATATGG + Intergenic
1199704318 X:150410915-150410937 GCCCAGGATGGCTTTGGATGCGG + Intronic
1200669833 Y:6074917-6074939 GCTCAGGGCAGCTTTGAATGTGG - Intergenic
1200720541 Y:6601134-6601156 GCTCAGGATGCATTTGAAAGGGG + Intergenic
1200983701 Y:9285260-9285282 GACCAGGAAGCTTTTGAATGGGG - Intergenic
1201276468 Y:12303328-12303350 GCTCAGGACAGCTTTGAATGTGG + Intergenic
1202126665 Y:21574442-21574464 GACCAGGAAGCTTTTGAATGGGG + Intergenic