ID: 1005143175

View in Genome Browser
Species Human (GRCh38)
Location 6:22657703-22657725
Sequence ACATGAAATGATGACAGATA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005143175_1005143179 10 Left 1005143175 6:22657703-22657725 CCGTATCTGTCATCATTTCATGT No data
Right 1005143179 6:22657736-22657758 CTGAGAGAAGCTGCCATCCTTGG No data
1005143175_1005143181 20 Left 1005143175 6:22657703-22657725 CCGTATCTGTCATCATTTCATGT No data
Right 1005143181 6:22657746-22657768 CTGCCATCCTTGGGCAACAAAGG No data
1005143175_1005143180 11 Left 1005143175 6:22657703-22657725 CCGTATCTGTCATCATTTCATGT No data
Right 1005143180 6:22657737-22657759 TGAGAGAAGCTGCCATCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005143175 Original CRISPR ACATGAAATGATGACAGATA CGG (reversed) Intergenic
No off target data available for this crispr