ID: 1005143177

View in Genome Browser
Species Human (GRCh38)
Location 6:22657726-22657748
Sequence CAGCTTCTCTCAGGCCTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005143177_1005143181 -3 Left 1005143177 6:22657726-22657748 CCTCAAAGGCCTGAGAGAAGCTG No data
Right 1005143181 6:22657746-22657768 CTGCCATCCTTGGGCAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005143177 Original CRISPR CAGCTTCTCTCAGGCCTTTG AGG (reversed) Intergenic
No off target data available for this crispr