ID: 1005144674

View in Genome Browser
Species Human (GRCh38)
Location 6:22675179-22675201
Sequence GTGCAGGTATCTTTGGAATA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005144674_1005144678 10 Left 1005144674 6:22675179-22675201 CCGTATTCCAAAGATACCTGCAC No data
Right 1005144678 6:22675212-22675234 ATTGAAGCATTATTCATAATGGG No data
1005144674_1005144677 9 Left 1005144674 6:22675179-22675201 CCGTATTCCAAAGATACCTGCAC No data
Right 1005144677 6:22675211-22675233 CATTGAAGCATTATTCATAATGG No data
1005144674_1005144679 20 Left 1005144674 6:22675179-22675201 CCGTATTCCAAAGATACCTGCAC No data
Right 1005144679 6:22675222-22675244 TATTCATAATGGGTAAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005144674 Original CRISPR GTGCAGGTATCTTTGGAATA CGG (reversed) Intergenic