ID: 1005144675

View in Genome Browser
Species Human (GRCh38)
Location 6:22675186-22675208
Sequence CATGAGAGTGCAGGTATCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005144675_1005144679 13 Left 1005144675 6:22675186-22675208 CCAAAGATACCTGCACTCTCATG No data
Right 1005144679 6:22675222-22675244 TATTCATAATGGGTAAGATATGG No data
1005144675_1005144677 2 Left 1005144675 6:22675186-22675208 CCAAAGATACCTGCACTCTCATG No data
Right 1005144677 6:22675211-22675233 CATTGAAGCATTATTCATAATGG No data
1005144675_1005144678 3 Left 1005144675 6:22675186-22675208 CCAAAGATACCTGCACTCTCATG No data
Right 1005144678 6:22675212-22675234 ATTGAAGCATTATTCATAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005144675 Original CRISPR CATGAGAGTGCAGGTATCTT TGG (reversed) Intergenic