ID: 1005144676

View in Genome Browser
Species Human (GRCh38)
Location 6:22675195-22675217
Sequence TTCAATGAACATGAGAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005144676_1005144677 -7 Left 1005144676 6:22675195-22675217 CCTGCACTCTCATGTTCATTGAA No data
Right 1005144677 6:22675211-22675233 CATTGAAGCATTATTCATAATGG No data
1005144676_1005144679 4 Left 1005144676 6:22675195-22675217 CCTGCACTCTCATGTTCATTGAA No data
Right 1005144679 6:22675222-22675244 TATTCATAATGGGTAAGATATGG No data
1005144676_1005144678 -6 Left 1005144676 6:22675195-22675217 CCTGCACTCTCATGTTCATTGAA No data
Right 1005144678 6:22675212-22675234 ATTGAAGCATTATTCATAATGGG No data
1005144676_1005144680 26 Left 1005144676 6:22675195-22675217 CCTGCACTCTCATGTTCATTGAA No data
Right 1005144680 6:22675244-22675266 GAAGCACTCTGTGTCCATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005144676 Original CRISPR TTCAATGAACATGAGAGTGC AGG (reversed) Intergenic