ID: 1005144677

View in Genome Browser
Species Human (GRCh38)
Location 6:22675211-22675233
Sequence CATTGAAGCATTATTCATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005144674_1005144677 9 Left 1005144674 6:22675179-22675201 CCGTATTCCAAAGATACCTGCAC No data
Right 1005144677 6:22675211-22675233 CATTGAAGCATTATTCATAATGG No data
1005144675_1005144677 2 Left 1005144675 6:22675186-22675208 CCAAAGATACCTGCACTCTCATG No data
Right 1005144677 6:22675211-22675233 CATTGAAGCATTATTCATAATGG No data
1005144676_1005144677 -7 Left 1005144676 6:22675195-22675217 CCTGCACTCTCATGTTCATTGAA No data
Right 1005144677 6:22675211-22675233 CATTGAAGCATTATTCATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005144677 Original CRISPR CATTGAAGCATTATTCATAA TGG Intergenic
No off target data available for this crispr