ID: 1005144678

View in Genome Browser
Species Human (GRCh38)
Location 6:22675212-22675234
Sequence ATTGAAGCATTATTCATAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005144674_1005144678 10 Left 1005144674 6:22675179-22675201 CCGTATTCCAAAGATACCTGCAC No data
Right 1005144678 6:22675212-22675234 ATTGAAGCATTATTCATAATGGG No data
1005144676_1005144678 -6 Left 1005144676 6:22675195-22675217 CCTGCACTCTCATGTTCATTGAA No data
Right 1005144678 6:22675212-22675234 ATTGAAGCATTATTCATAATGGG No data
1005144675_1005144678 3 Left 1005144675 6:22675186-22675208 CCAAAGATACCTGCACTCTCATG No data
Right 1005144678 6:22675212-22675234 ATTGAAGCATTATTCATAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005144678 Original CRISPR ATTGAAGCATTATTCATAAT GGG Intergenic
No off target data available for this crispr