ID: 1005145041

View in Genome Browser
Species Human (GRCh38)
Location 6:22679880-22679902
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005145039_1005145041 -1 Left 1005145039 6:22679858-22679880 CCTGTTAGCTAGAATTTGTAAAT No data
Right 1005145041 6:22679880-22679902 TTTTGCCAATGAAAGAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005145041 Original CRISPR TTTTGCCAATGAAAGAACCA GGG Intergenic
No off target data available for this crispr