ID: 1005148182

View in Genome Browser
Species Human (GRCh38)
Location 6:22716711-22716733
Sequence CAGGTTATTCTTCCAGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005148182_1005148185 -4 Left 1005148182 6:22716711-22716733 CCTGCAACTGGAAGAATAACCTG No data
Right 1005148185 6:22716730-22716752 CCTGAAATTACATTGATAATGGG No data
1005148182_1005148183 -5 Left 1005148182 6:22716711-22716733 CCTGCAACTGGAAGAATAACCTG No data
Right 1005148183 6:22716729-22716751 ACCTGAAATTACATTGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005148182 Original CRISPR CAGGTTATTCTTCCAGTTGC AGG (reversed) Intergenic
No off target data available for this crispr