ID: 1005150923

View in Genome Browser
Species Human (GRCh38)
Location 6:22749576-22749598
Sequence CATGTGAAGAAGGAACAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005150923_1005150926 -7 Left 1005150923 6:22749576-22749598 CCAGTCTGTTCCTTCTTCACATG No data
Right 1005150926 6:22749592-22749614 TCACATGGAATGCCCCTCTTAGG No data
1005150923_1005150927 -3 Left 1005150923 6:22749576-22749598 CCAGTCTGTTCCTTCTTCACATG No data
Right 1005150927 6:22749596-22749618 ATGGAATGCCCCTCTTAGGAAGG No data
1005150923_1005150931 24 Left 1005150923 6:22749576-22749598 CCAGTCTGTTCCTTCTTCACATG No data
Right 1005150931 6:22749623-22749645 AACATCAGCTAGTGAACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005150923 Original CRISPR CATGTGAAGAAGGAACAGAC TGG (reversed) Intergenic
No off target data available for this crispr