ID: 1005152531

View in Genome Browser
Species Human (GRCh38)
Location 6:22768656-22768678
Sequence AACAGTGGTTAGAAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005152531_1005152536 5 Left 1005152531 6:22768656-22768678 CCTTCCTTCTTCTAACCACTGTT No data
Right 1005152536 6:22768684-22768706 CATTTTAGGTGACTTTTGTCTGG No data
1005152531_1005152533 -9 Left 1005152531 6:22768656-22768678 CCTTCCTTCTTCTAACCACTGTT No data
Right 1005152533 6:22768670-22768692 ACCACTGTTACCATCATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005152531 Original CRISPR AACAGTGGTTAGAAGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr