ID: 1005152533

View in Genome Browser
Species Human (GRCh38)
Location 6:22768670-22768692
Sequence ACCACTGTTACCATCATTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005152523_1005152533 26 Left 1005152523 6:22768621-22768643 CCTTATGTAAATTAGGCCTTCCC No data
Right 1005152533 6:22768670-22768692 ACCACTGTTACCATCATTTTAGG No data
1005152530_1005152533 -2 Left 1005152530 6:22768649-22768671 CCAATTTCCTTCCTTCTTCTAAC No data
Right 1005152533 6:22768670-22768692 ACCACTGTTACCATCATTTTAGG No data
1005152528_1005152533 3 Left 1005152528 6:22768644-22768666 CCAGCCCAATTTCCTTCCTTCTT No data
Right 1005152533 6:22768670-22768692 ACCACTGTTACCATCATTTTAGG No data
1005152527_1005152533 4 Left 1005152527 6:22768643-22768665 CCCAGCCCAATTTCCTTCCTTCT No data
Right 1005152533 6:22768670-22768692 ACCACTGTTACCATCATTTTAGG No data
1005152525_1005152533 6 Left 1005152525 6:22768641-22768663 CCCCCAGCCCAATTTCCTTCCTT No data
Right 1005152533 6:22768670-22768692 ACCACTGTTACCATCATTTTAGG No data
1005152529_1005152533 -1 Left 1005152529 6:22768648-22768670 CCCAATTTCCTTCCTTCTTCTAA No data
Right 1005152533 6:22768670-22768692 ACCACTGTTACCATCATTTTAGG No data
1005152526_1005152533 5 Left 1005152526 6:22768642-22768664 CCCCAGCCCAATTTCCTTCCTTC No data
Right 1005152533 6:22768670-22768692 ACCACTGTTACCATCATTTTAGG No data
1005152524_1005152533 10 Left 1005152524 6:22768637-22768659 CCTTCCCCCAGCCCAATTTCCTT No data
Right 1005152533 6:22768670-22768692 ACCACTGTTACCATCATTTTAGG No data
1005152531_1005152533 -9 Left 1005152531 6:22768656-22768678 CCTTCCTTCTTCTAACCACTGTT No data
Right 1005152533 6:22768670-22768692 ACCACTGTTACCATCATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005152533 Original CRISPR ACCACTGTTACCATCATTTT AGG Intergenic
No off target data available for this crispr