ID: 1005152536

View in Genome Browser
Species Human (GRCh38)
Location 6:22768684-22768706
Sequence CATTTTAGGTGACTTTTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005152530_1005152536 12 Left 1005152530 6:22768649-22768671 CCAATTTCCTTCCTTCTTCTAAC No data
Right 1005152536 6:22768684-22768706 CATTTTAGGTGACTTTTGTCTGG No data
1005152526_1005152536 19 Left 1005152526 6:22768642-22768664 CCCCAGCCCAATTTCCTTCCTTC No data
Right 1005152536 6:22768684-22768706 CATTTTAGGTGACTTTTGTCTGG No data
1005152531_1005152536 5 Left 1005152531 6:22768656-22768678 CCTTCCTTCTTCTAACCACTGTT No data
Right 1005152536 6:22768684-22768706 CATTTTAGGTGACTTTTGTCTGG No data
1005152528_1005152536 17 Left 1005152528 6:22768644-22768666 CCAGCCCAATTTCCTTCCTTCTT No data
Right 1005152536 6:22768684-22768706 CATTTTAGGTGACTTTTGTCTGG No data
1005152534_1005152536 -10 Left 1005152534 6:22768671-22768693 CCACTGTTACCATCATTTTAGGT No data
Right 1005152536 6:22768684-22768706 CATTTTAGGTGACTTTTGTCTGG No data
1005152525_1005152536 20 Left 1005152525 6:22768641-22768663 CCCCCAGCCCAATTTCCTTCCTT No data
Right 1005152536 6:22768684-22768706 CATTTTAGGTGACTTTTGTCTGG No data
1005152524_1005152536 24 Left 1005152524 6:22768637-22768659 CCTTCCCCCAGCCCAATTTCCTT No data
Right 1005152536 6:22768684-22768706 CATTTTAGGTGACTTTTGTCTGG No data
1005152532_1005152536 1 Left 1005152532 6:22768660-22768682 CCTTCTTCTAACCACTGTTACCA No data
Right 1005152536 6:22768684-22768706 CATTTTAGGTGACTTTTGTCTGG No data
1005152529_1005152536 13 Left 1005152529 6:22768648-22768670 CCCAATTTCCTTCCTTCTTCTAA No data
Right 1005152536 6:22768684-22768706 CATTTTAGGTGACTTTTGTCTGG No data
1005152527_1005152536 18 Left 1005152527 6:22768643-22768665 CCCAGCCCAATTTCCTTCCTTCT No data
Right 1005152536 6:22768684-22768706 CATTTTAGGTGACTTTTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005152536 Original CRISPR CATTTTAGGTGACTTTTGTC TGG Intergenic
No off target data available for this crispr