ID: 1005156017

View in Genome Browser
Species Human (GRCh38)
Location 6:22807416-22807438
Sequence GTGCCCTACAAAATACCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005156017_1005156020 -5 Left 1005156017 6:22807416-22807438 CCTTAGGGTATTTTGTAGGGCAC No data
Right 1005156020 6:22807434-22807456 GGCACCATATGCTCTGGGATTGG No data
1005156017_1005156024 16 Left 1005156017 6:22807416-22807438 CCTTAGGGTATTTTGTAGGGCAC No data
Right 1005156024 6:22807455-22807477 GGGTATTAACACAGCATGGCAGG No data
1005156017_1005156023 12 Left 1005156017 6:22807416-22807438 CCTTAGGGTATTTTGTAGGGCAC No data
Right 1005156023 6:22807451-22807473 GATTGGGTATTAACACAGCATGG No data
1005156017_1005156021 -4 Left 1005156017 6:22807416-22807438 CCTTAGGGTATTTTGTAGGGCAC No data
Right 1005156021 6:22807435-22807457 GCACCATATGCTCTGGGATTGGG No data
1005156017_1005156019 -10 Left 1005156017 6:22807416-22807438 CCTTAGGGTATTTTGTAGGGCAC No data
Right 1005156019 6:22807429-22807451 TGTAGGGCACCATATGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005156017 Original CRISPR GTGCCCTACAAAATACCCTA AGG (reversed) Intergenic
No off target data available for this crispr