ID: 1005157379

View in Genome Browser
Species Human (GRCh38)
Location 6:22822151-22822173
Sequence CAGTGAGGGCCTGTAGGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005157379_1005157384 -5 Left 1005157379 6:22822151-22822173 CCAATTCCTACAGGCCCTCACTG No data
Right 1005157384 6:22822169-22822191 CACTGTCCACAACAAGGCCCAGG No data
1005157379_1005157392 15 Left 1005157379 6:22822151-22822173 CCAATTCCTACAGGCCCTCACTG No data
Right 1005157392 6:22822189-22822211 AGGGGAAGATTATGGGCTTGTGG No data
1005157379_1005157388 7 Left 1005157379 6:22822151-22822173 CCAATTCCTACAGGCCCTCACTG No data
Right 1005157388 6:22822181-22822203 CAAGGCCCAGGGGAAGATTATGG No data
1005157379_1005157386 -3 Left 1005157379 6:22822151-22822173 CCAATTCCTACAGGCCCTCACTG No data
Right 1005157386 6:22822171-22822193 CTGTCCACAACAAGGCCCAGGGG No data
1005157379_1005157389 8 Left 1005157379 6:22822151-22822173 CCAATTCCTACAGGCCCTCACTG No data
Right 1005157389 6:22822182-22822204 AAGGCCCAGGGGAAGATTATGGG No data
1005157379_1005157385 -4 Left 1005157379 6:22822151-22822173 CCAATTCCTACAGGCCCTCACTG No data
Right 1005157385 6:22822170-22822192 ACTGTCCACAACAAGGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005157379 Original CRISPR CAGTGAGGGCCTGTAGGAAT TGG (reversed) Intergenic
No off target data available for this crispr