ID: 1005159449

View in Genome Browser
Species Human (GRCh38)
Location 6:22842241-22842263
Sequence GTACATGTGAATATACAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005159446_1005159449 2 Left 1005159446 6:22842216-22842238 CCTATAAGTGGGAGCTAAACAAA No data
Right 1005159449 6:22842241-22842263 GTACATGTGAATATACAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005159449 Original CRISPR GTACATGTGAATATACAGAG TGG Intergenic
No off target data available for this crispr