ID: 1005159505

View in Genome Browser
Species Human (GRCh38)
Location 6:22842866-22842888
Sequence CAGCTGTGACAAATTAGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005159502_1005159505 -2 Left 1005159502 6:22842845-22842867 CCATGCCCTTCTTAGCTTGGACA No data
Right 1005159505 6:22842866-22842888 CAGCTGTGACAAATTAGCATAGG No data
1005159503_1005159505 -7 Left 1005159503 6:22842850-22842872 CCCTTCTTAGCTTGGACAGCTGT No data
Right 1005159505 6:22842866-22842888 CAGCTGTGACAAATTAGCATAGG No data
1005159504_1005159505 -8 Left 1005159504 6:22842851-22842873 CCTTCTTAGCTTGGACAGCTGTG No data
Right 1005159505 6:22842866-22842888 CAGCTGTGACAAATTAGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005159505 Original CRISPR CAGCTGTGACAAATTAGCAT AGG Intergenic
No off target data available for this crispr