ID: 1005159534

View in Genome Browser
Species Human (GRCh38)
Location 6:22843136-22843158
Sequence GATCCCACCTCCAAGTACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005159528_1005159534 -5 Left 1005159528 6:22843118-22843140 CCCCAATTACCTCCCAAAGATCC No data
Right 1005159534 6:22843136-22843158 GATCCCACCTCCAAGTACTTTGG No data
1005159530_1005159534 -7 Left 1005159530 6:22843120-22843142 CCAATTACCTCCCAAAGATCCCA No data
Right 1005159534 6:22843136-22843158 GATCCCACCTCCAAGTACTTTGG No data
1005159529_1005159534 -6 Left 1005159529 6:22843119-22843141 CCCAATTACCTCCCAAAGATCCC No data
Right 1005159534 6:22843136-22843158 GATCCCACCTCCAAGTACTTTGG No data
1005159527_1005159534 5 Left 1005159527 6:22843108-22843130 CCTAATCTAACCCCAATTACCTC No data
Right 1005159534 6:22843136-22843158 GATCCCACCTCCAAGTACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005159534 Original CRISPR GATCCCACCTCCAAGTACTT TGG Intergenic
No off target data available for this crispr