ID: 1005162842

View in Genome Browser
Species Human (GRCh38)
Location 6:22884348-22884370
Sequence ATTTACTTATGGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005162842_1005162845 5 Left 1005162842 6:22884348-22884370 CCTTCACTCTTCCATAAGTAAAT No data
Right 1005162845 6:22884376-22884398 GTAGGCTGAACCATATGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005162842 Original CRISPR ATTTACTTATGGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr