ID: 1005164580

View in Genome Browser
Species Human (GRCh38)
Location 6:22905003-22905025
Sequence TTAGTTTATAAGCTATCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005164573_1005164580 24 Left 1005164573 6:22904956-22904978 CCTTGTCAGGTTTGATGTAGTGA No data
Right 1005164580 6:22905003-22905025 TTAGTTTATAAGCTATCTATGGG No data
1005164575_1005164580 -5 Left 1005164575 6:22904985-22905007 CCCTGAATTCCCAGTTCTTTAGT No data
Right 1005164580 6:22905003-22905025 TTAGTTTATAAGCTATCTATGGG No data
1005164576_1005164580 -6 Left 1005164576 6:22904986-22905008 CCTGAATTCCCAGTTCTTTAGTT No data
Right 1005164580 6:22905003-22905025 TTAGTTTATAAGCTATCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005164580 Original CRISPR TTAGTTTATAAGCTATCTAT GGG Intergenic
No off target data available for this crispr