ID: 1005166447

View in Genome Browser
Species Human (GRCh38)
Location 6:22927286-22927308
Sequence CATACCTAACAGTTTAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005166447_1005166451 19 Left 1005166447 6:22927286-22927308 CCAGCATTAAACTGTTAGGTATG No data
Right 1005166451 6:22927328-22927350 ATGAAAAGATCTGTGGTCTCAGG No data
1005166447_1005166450 12 Left 1005166447 6:22927286-22927308 CCAGCATTAAACTGTTAGGTATG No data
Right 1005166450 6:22927321-22927343 AATATAAATGAAAAGATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005166447 Original CRISPR CATACCTAACAGTTTAATGC TGG (reversed) Intergenic
No off target data available for this crispr