ID: 1005169314

View in Genome Browser
Species Human (GRCh38)
Location 6:22964197-22964219
Sequence CACAAGAGAATGCAACCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005169313_1005169314 11 Left 1005169313 6:22964163-22964185 CCACTGGAGTAAATGAGAAAATC No data
Right 1005169314 6:22964197-22964219 CACAAGAGAATGCAACCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005169314 Original CRISPR CACAAGAGAATGCAACCCAA AGG Intergenic
No off target data available for this crispr