ID: 1005173453

View in Genome Browser
Species Human (GRCh38)
Location 6:23015052-23015074
Sequence TTCCACTTCCTCCTATGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005173453_1005173457 -10 Left 1005173453 6:23015052-23015074 CCATGTCATAGGAGGAAGTGGAA No data
Right 1005173457 6:23015065-23015087 GGAAGTGGAAGGTGGAAGGAAGG No data
1005173453_1005173459 -3 Left 1005173453 6:23015052-23015074 CCATGTCATAGGAGGAAGTGGAA No data
Right 1005173459 6:23015072-23015094 GAAGGTGGAAGGAAGGGTTTTGG No data
1005173453_1005173460 2 Left 1005173453 6:23015052-23015074 CCATGTCATAGGAGGAAGTGGAA No data
Right 1005173460 6:23015077-23015099 TGGAAGGAAGGGTTTTGGATAGG No data
1005173453_1005173458 -9 Left 1005173453 6:23015052-23015074 CCATGTCATAGGAGGAAGTGGAA No data
Right 1005173458 6:23015066-23015088 GAAGTGGAAGGTGGAAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005173453 Original CRISPR TTCCACTTCCTCCTATGACA TGG (reversed) Intergenic
No off target data available for this crispr