ID: 1005181882

View in Genome Browser
Species Human (GRCh38)
Location 6:23115554-23115576
Sequence CCCTTGGTATGGAGAGTACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005181882_1005181889 27 Left 1005181882 6:23115554-23115576 CCACGTACTCTCCATACCAAGGG No data
Right 1005181889 6:23115604-23115626 CTCTCCAGACCAAGAGCAGAGGG No data
1005181882_1005181888 26 Left 1005181882 6:23115554-23115576 CCACGTACTCTCCATACCAAGGG No data
Right 1005181888 6:23115603-23115625 GCTCTCCAGACCAAGAGCAGAGG No data
1005181882_1005181885 -8 Left 1005181882 6:23115554-23115576 CCACGTACTCTCCATACCAAGGG No data
Right 1005181885 6:23115569-23115591 ACCAAGGGCAGTGAGAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005181882 Original CRISPR CCCTTGGTATGGAGAGTACG TGG (reversed) Intergenic
No off target data available for this crispr