ID: 1005185170

View in Genome Browser
Species Human (GRCh38)
Location 6:23157082-23157104
Sequence GACAGCTGTTGGGCTGTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005185166_1005185170 11 Left 1005185166 6:23157048-23157070 CCATCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 1005185170 6:23157082-23157104 GACAGCTGTTGGGCTGTTATTGG No data
1005185165_1005185170 15 Left 1005185165 6:23157044-23157066 CCTGCCATCTTCTGCAGATAACT 0: 185
1: 187
2: 104
3: 111
4: 225
Right 1005185170 6:23157082-23157104 GACAGCTGTTGGGCTGTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005185170 Original CRISPR GACAGCTGTTGGGCTGTTAT TGG Intergenic
No off target data available for this crispr