ID: 1005193077

View in Genome Browser
Species Human (GRCh38)
Location 6:23250072-23250094
Sequence AATGAATTCACATTTTAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005193077_1005193078 24 Left 1005193077 6:23250072-23250094 CCATTTTAAAATGTGAATTCATT No data
Right 1005193078 6:23250119-23250141 TTCTTGTGACCACTGTGTAGTGG No data
1005193077_1005193080 26 Left 1005193077 6:23250072-23250094 CCATTTTAAAATGTGAATTCATT No data
Right 1005193080 6:23250121-23250143 CTTGTGACCACTGTGTAGTGGGG No data
1005193077_1005193079 25 Left 1005193077 6:23250072-23250094 CCATTTTAAAATGTGAATTCATT No data
Right 1005193079 6:23250120-23250142 TCTTGTGACCACTGTGTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005193077 Original CRISPR AATGAATTCACATTTTAAAA TGG (reversed) Intergenic