ID: 1005193079

View in Genome Browser
Species Human (GRCh38)
Location 6:23250120-23250142
Sequence TCTTGTGACCACTGTGTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005193077_1005193079 25 Left 1005193077 6:23250072-23250094 CCATTTTAAAATGTGAATTCATT No data
Right 1005193079 6:23250120-23250142 TCTTGTGACCACTGTGTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005193079 Original CRISPR TCTTGTGACCACTGTGTAGT GGG Intergenic
No off target data available for this crispr