ID: 1005194260

View in Genome Browser
Species Human (GRCh38)
Location 6:23264794-23264816
Sequence GGGCCTGTTTAATGGTCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005194260_1005194266 14 Left 1005194260 6:23264794-23264816 CCTGGTGACCATTAAACAGGCCC No data
Right 1005194266 6:23264831-23264853 CCTTATATGAAGAATTTAGAAGG No data
1005194260_1005194267 15 Left 1005194260 6:23264794-23264816 CCTGGTGACCATTAAACAGGCCC No data
Right 1005194267 6:23264832-23264854 CTTATATGAAGAATTTAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005194260 Original CRISPR GGGCCTGTTTAATGGTCACC AGG (reversed) Intergenic
No off target data available for this crispr