ID: 1005194262

View in Genome Browser
Species Human (GRCh38)
Location 6:23264814-23264836
Sequence ATAAGGAGTTCTTGTATCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005194262_1005194268 11 Left 1005194262 6:23264814-23264836 CCCCAGATACAAGAACTCCTTAT No data
Right 1005194268 6:23264848-23264870 AGAAGGGAGCAAAGACCGCCTGG No data
1005194262_1005194266 -6 Left 1005194262 6:23264814-23264836 CCCCAGATACAAGAACTCCTTAT No data
Right 1005194266 6:23264831-23264853 CCTTATATGAAGAATTTAGAAGG No data
1005194262_1005194267 -5 Left 1005194262 6:23264814-23264836 CCCCAGATACAAGAACTCCTTAT No data
Right 1005194267 6:23264832-23264854 CTTATATGAAGAATTTAGAAGGG No data
1005194262_1005194270 26 Left 1005194262 6:23264814-23264836 CCCCAGATACAAGAACTCCTTAT No data
Right 1005194270 6:23264863-23264885 CCGCCTGGTGACAATCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005194262 Original CRISPR ATAAGGAGTTCTTGTATCTG GGG (reversed) Intergenic
No off target data available for this crispr