ID: 1005194266

View in Genome Browser
Species Human (GRCh38)
Location 6:23264831-23264853
Sequence CCTTATATGAAGAATTTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005194264_1005194266 -8 Left 1005194264 6:23264816-23264838 CCAGATACAAGAACTCCTTATAT No data
Right 1005194266 6:23264831-23264853 CCTTATATGAAGAATTTAGAAGG No data
1005194261_1005194266 6 Left 1005194261 6:23264802-23264824 CCATTAAACAGGCCCCAGATACA No data
Right 1005194266 6:23264831-23264853 CCTTATATGAAGAATTTAGAAGG No data
1005194263_1005194266 -7 Left 1005194263 6:23264815-23264837 CCCAGATACAAGAACTCCTTATA No data
Right 1005194266 6:23264831-23264853 CCTTATATGAAGAATTTAGAAGG No data
1005194262_1005194266 -6 Left 1005194262 6:23264814-23264836 CCCCAGATACAAGAACTCCTTAT No data
Right 1005194266 6:23264831-23264853 CCTTATATGAAGAATTTAGAAGG No data
1005194260_1005194266 14 Left 1005194260 6:23264794-23264816 CCTGGTGACCATTAAACAGGCCC No data
Right 1005194266 6:23264831-23264853 CCTTATATGAAGAATTTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005194266 Original CRISPR CCTTATATGAAGAATTTAGA AGG Intergenic
No off target data available for this crispr