ID: 1005198298

View in Genome Browser
Species Human (GRCh38)
Location 6:23314386-23314408
Sequence CTTCCTTTCTGCTCCTGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005198295_1005198298 -6 Left 1005198295 6:23314369-23314391 CCTTGCTCTCTAGCTTCCTTCCT No data
Right 1005198298 6:23314386-23314408 CTTCCTTTCTGCTCCTGCATGGG No data
1005198294_1005198298 4 Left 1005198294 6:23314359-23314381 CCTGTTCTCACCTTGCTCTCTAG No data
Right 1005198298 6:23314386-23314408 CTTCCTTTCTGCTCCTGCATGGG No data
1005198293_1005198298 8 Left 1005198293 6:23314355-23314377 CCTTCCTGTTCTCACCTTGCTCT No data
Right 1005198298 6:23314386-23314408 CTTCCTTTCTGCTCCTGCATGGG No data
1005198292_1005198298 24 Left 1005198292 6:23314339-23314361 CCTCTTCAGGGCAAGGCCTTCCT No data
Right 1005198298 6:23314386-23314408 CTTCCTTTCTGCTCCTGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005198298 Original CRISPR CTTCCTTTCTGCTCCTGCAT GGG Intergenic
No off target data available for this crispr