ID: 1005199540

View in Genome Browser
Species Human (GRCh38)
Location 6:23327573-23327595
Sequence CAAGATGGTGATAGTGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005199540_1005199545 19 Left 1005199540 6:23327573-23327595 CCACCATCACTATCACCATCTTG No data
Right 1005199545 6:23327615-23327637 CAGGTATATTTTGTAATTCTTGG No data
1005199540_1005199543 0 Left 1005199540 6:23327573-23327595 CCACCATCACTATCACCATCTTG No data
Right 1005199543 6:23327596-23327618 AAGAGTTTCAGTGTCCTTTCAGG No data
1005199540_1005199546 25 Left 1005199540 6:23327573-23327595 CCACCATCACTATCACCATCTTG No data
Right 1005199546 6:23327621-23327643 TATTTTGTAATTCTTGGTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005199540 Original CRISPR CAAGATGGTGATAGTGATGG TGG (reversed) Intergenic
No off target data available for this crispr