ID: 1005199543

View in Genome Browser
Species Human (GRCh38)
Location 6:23327596-23327618
Sequence AAGAGTTTCAGTGTCCTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005199541_1005199543 -3 Left 1005199541 6:23327576-23327598 CCATCACTATCACCATCTTGAAG No data
Right 1005199543 6:23327596-23327618 AAGAGTTTCAGTGTCCTTTCAGG No data
1005199540_1005199543 0 Left 1005199540 6:23327573-23327595 CCACCATCACTATCACCATCTTG No data
Right 1005199543 6:23327596-23327618 AAGAGTTTCAGTGTCCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005199543 Original CRISPR AAGAGTTTCAGTGTCCTTTC AGG Intergenic
No off target data available for this crispr