ID: 1005203066

View in Genome Browser
Species Human (GRCh38)
Location 6:23369154-23369176
Sequence CTCACTCCTGCCACCTATCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005203063_1005203066 20 Left 1005203063 6:23369111-23369133 CCTTGTGATTAAAAATGCAATGG No data
Right 1005203066 6:23369154-23369176 CTCACTCCTGCCACCTATCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005203066 Original CRISPR CTCACTCCTGCCACCTATCC CGG Intergenic
No off target data available for this crispr