ID: 1005209112

View in Genome Browser
Species Human (GRCh38)
Location 6:23440548-23440570
Sequence AAAAAAAAGGAAGGAAATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005209112_1005209116 27 Left 1005209112 6:23440548-23440570 CCCTCATTTCCTTCCTTTTTTTT No data
Right 1005209116 6:23440598-23440620 TCCACCCAACTCCACATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005209112 Original CRISPR AAAAAAAAGGAAGGAAATGA GGG (reversed) Intergenic
No off target data available for this crispr