ID: 1005209114

View in Genome Browser
Species Human (GRCh38)
Location 6:23440557-23440579
Sequence AAAAAAAAAAAAAAAAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253652
Summary {0: 927, 1: 9953, 2: 46055, 3: 63146, 4: 133571}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005209114_1005209116 18 Left 1005209114 6:23440557-23440579 CCTTCCTTTTTTTTTTTTTTTTT 0: 927
1: 9953
2: 46055
3: 63146
4: 133571
Right 1005209116 6:23440598-23440620 TCCACCCAACTCCACATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005209114 Original CRISPR AAAAAAAAAAAAAAAAAGGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr