ID: 1005209115

View in Genome Browser
Species Human (GRCh38)
Location 6:23440561-23440583
Sequence AAAAAAAAAAAAAAAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 322213
Summary {0: 22235, 1: 21563, 2: 42018, 3: 80771, 4: 155626}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005209115_1005209116 14 Left 1005209115 6:23440561-23440583 CCTTTTTTTTTTTTTTTTTTTTT 0: 22235
1: 21563
2: 42018
3: 80771
4: 155626
Right 1005209116 6:23440598-23440620 TCCACCCAACTCCACATTTTAGG No data
1005209115_1005209121 29 Left 1005209115 6:23440561-23440583 CCTTTTTTTTTTTTTTTTTTTTT 0: 22235
1: 21563
2: 42018
3: 80771
4: 155626
Right 1005209121 6:23440613-23440635 ATTTTAGGAAAAAAACAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005209115 Original CRISPR AAAAAAAAAAAAAAAAAAAA AGG (reversed) Intergenic
Too many off-targets to display for this crispr