ID: 1005209116

View in Genome Browser
Species Human (GRCh38)
Location 6:23440598-23440620
Sequence TCCACCCAACTCCACATTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005209113_1005209116 26 Left 1005209113 6:23440549-23440571 CCTCATTTCCTTCCTTTTTTTTT No data
Right 1005209116 6:23440598-23440620 TCCACCCAACTCCACATTTTAGG No data
1005209112_1005209116 27 Left 1005209112 6:23440548-23440570 CCCTCATTTCCTTCCTTTTTTTT No data
Right 1005209116 6:23440598-23440620 TCCACCCAACTCCACATTTTAGG No data
1005209115_1005209116 14 Left 1005209115 6:23440561-23440583 CCTTTTTTTTTTTTTTTTTTTTT 0: 22235
1: 21563
2: 42018
3: 80771
4: 155626
Right 1005209116 6:23440598-23440620 TCCACCCAACTCCACATTTTAGG No data
1005209114_1005209116 18 Left 1005209114 6:23440557-23440579 CCTTCCTTTTTTTTTTTTTTTTT 0: 927
1: 9953
2: 46055
3: 63146
4: 133571
Right 1005209116 6:23440598-23440620 TCCACCCAACTCCACATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005209116 Original CRISPR TCCACCCAACTCCACATTTT AGG Intergenic
No off target data available for this crispr