ID: 1005215082

View in Genome Browser
Species Human (GRCh38)
Location 6:23516882-23516904
Sequence GGAGGGCATAAGAGAATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005215082_1005215084 -9 Left 1005215082 6:23516882-23516904 CCAGAGATTCTCTTATGCCCTCC No data
Right 1005215084 6:23516896-23516918 ATGCCCTCCTTGAGAGACCAGGG No data
1005215082_1005215089 20 Left 1005215082 6:23516882-23516904 CCAGAGATTCTCTTATGCCCTCC No data
Right 1005215089 6:23516925-23516947 AAATATTACTTAAATCTGCTTGG No data
1005215082_1005215090 29 Left 1005215082 6:23516882-23516904 CCAGAGATTCTCTTATGCCCTCC No data
Right 1005215090 6:23516934-23516956 TTAAATCTGCTTGGATTTTTAGG No data
1005215082_1005215083 -10 Left 1005215082 6:23516882-23516904 CCAGAGATTCTCTTATGCCCTCC No data
Right 1005215083 6:23516895-23516917 TATGCCCTCCTTGAGAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005215082 Original CRISPR GGAGGGCATAAGAGAATCTC TGG (reversed) Intergenic