ID: 1005215083

View in Genome Browser
Species Human (GRCh38)
Location 6:23516895-23516917
Sequence TATGCCCTCCTTGAGAGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005215082_1005215083 -10 Left 1005215082 6:23516882-23516904 CCAGAGATTCTCTTATGCCCTCC No data
Right 1005215083 6:23516895-23516917 TATGCCCTCCTTGAGAGACCAGG No data
1005215081_1005215083 -9 Left 1005215081 6:23516881-23516903 CCCAGAGATTCTCTTATGCCCTC No data
Right 1005215083 6:23516895-23516917 TATGCCCTCCTTGAGAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005215083 Original CRISPR TATGCCCTCCTTGAGAGACC AGG Intergenic