ID: 1005215084

View in Genome Browser
Species Human (GRCh38)
Location 6:23516896-23516918
Sequence ATGCCCTCCTTGAGAGACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005215082_1005215084 -9 Left 1005215082 6:23516882-23516904 CCAGAGATTCTCTTATGCCCTCC No data
Right 1005215084 6:23516896-23516918 ATGCCCTCCTTGAGAGACCAGGG No data
1005215081_1005215084 -8 Left 1005215081 6:23516881-23516903 CCCAGAGATTCTCTTATGCCCTC No data
Right 1005215084 6:23516896-23516918 ATGCCCTCCTTGAGAGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005215084 Original CRISPR ATGCCCTCCTTGAGAGACCA GGG Intergenic