ID: 1005215085

View in Genome Browser
Species Human (GRCh38)
Location 6:23516899-23516921
Sequence TATCCCTGGTCTCTCAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005215085_1005215091 19 Left 1005215085 6:23516899-23516921 CCCTCCTTGAGAGACCAGGGATA No data
Right 1005215091 6:23516941-23516963 TGCTTGGATTTTTAGGAAACTGG No data
1005215085_1005215090 12 Left 1005215085 6:23516899-23516921 CCCTCCTTGAGAGACCAGGGATA No data
Right 1005215090 6:23516934-23516956 TTAAATCTGCTTGGATTTTTAGG No data
1005215085_1005215089 3 Left 1005215085 6:23516899-23516921 CCCTCCTTGAGAGACCAGGGATA No data
Right 1005215089 6:23516925-23516947 AAATATTACTTAAATCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005215085 Original CRISPR TATCCCTGGTCTCTCAAGGA GGG (reversed) Intergenic