ID: 1005215086

View in Genome Browser
Species Human (GRCh38)
Location 6:23516900-23516922
Sequence TTATCCCTGGTCTCTCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005215086_1005215089 2 Left 1005215086 6:23516900-23516922 CCTCCTTGAGAGACCAGGGATAA No data
Right 1005215089 6:23516925-23516947 AAATATTACTTAAATCTGCTTGG No data
1005215086_1005215091 18 Left 1005215086 6:23516900-23516922 CCTCCTTGAGAGACCAGGGATAA No data
Right 1005215091 6:23516941-23516963 TGCTTGGATTTTTAGGAAACTGG No data
1005215086_1005215090 11 Left 1005215086 6:23516900-23516922 CCTCCTTGAGAGACCAGGGATAA No data
Right 1005215090 6:23516934-23516956 TTAAATCTGCTTGGATTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005215086 Original CRISPR TTATCCCTGGTCTCTCAAGG AGG (reversed) Intergenic