ID: 1005215087

View in Genome Browser
Species Human (GRCh38)
Location 6:23516903-23516925
Sequence TTGTTATCCCTGGTCTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005215087_1005215091 15 Left 1005215087 6:23516903-23516925 CCTTGAGAGACCAGGGATAACAA No data
Right 1005215091 6:23516941-23516963 TGCTTGGATTTTTAGGAAACTGG No data
1005215087_1005215090 8 Left 1005215087 6:23516903-23516925 CCTTGAGAGACCAGGGATAACAA No data
Right 1005215090 6:23516934-23516956 TTAAATCTGCTTGGATTTTTAGG No data
1005215087_1005215089 -1 Left 1005215087 6:23516903-23516925 CCTTGAGAGACCAGGGATAACAA No data
Right 1005215089 6:23516925-23516947 AAATATTACTTAAATCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005215087 Original CRISPR TTGTTATCCCTGGTCTCTCA AGG (reversed) Intergenic